Overview

Comprehensive Description

Biology

Adults occur in pond, lakes and sluggish mud-bottomed pools of creeks and small to medium rivers. Often found in vegetation. Oviparous (Ref. 205). Feeds on small crustaceans and insects (Ref. 27549).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Adults occur in pond, lakes and sluggish mud-bottomed pools of creeks and small to medium rivers. Often found in vegetation. Oviparous (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Range includes the Lake Ontario basin and St. Lawrence River drainage, southern Quebec, eastern Ontario, and New York; and Atlantic Slope drainages from southern Maine south to the James River drainage of Virginia (apparently extirpated from the Potomac and Rappahannock river drainages); the species is also known from the Neuse River drainage, eastern North Carolina (probably extirpated there and also in the Chowan River drainage), and the Santee River drainage, South Carolina (Burkhead and Jenkins 1991). Range has been significantly reduced in Massachusetts, New Jersey, Pennsylvania, Maryland, and, apparently, also in the Carolinas and elsewhere.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (200,000-2,500,000 square km (about 80,000-1,000,000 square miles)) Range includes the Lake Ontario basin and St. Lawrence River drainage, southern Quebec, eastern Ontario, and New York; and Atlantic Slope drainages from southern Maine south to the James River drainage of Virginia (apparently extirpated from the Potomac and Rappahannock river drainages); the species is also known from the Neuse River drainage, eastern North Carolina (probably extirpated there and also in the Chowan River drainage), and the Santee River drainage, South Carolina (Burkhead and Jenkins 1991). Range has been significantly reduced in Massachusetts, New Jersey, Pennsylvania, Maryland, and, apparently, also in the Carolinas and elsewhere.

Please note that the watershed distribution map for this species needs to be updated; the bridle shiner no longer occurs in some of the areas that are indicated as the current distribution.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North America: St. Lawrence-Lake Ontario drainage in Quebec and Ontario in Canada, and New York in the USA; Atlantic Slope drainages from southern Maine, USA to Roanoke River system in southern Virginia, USA; isolated population in lower Neuse River drainage in eastern North Carolina, USA.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern North America.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Length: 5 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Maximum size: 65 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

6.5 cm TL (male/unsexed; (Ref. 5723))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Habitat ranges from warm-water small creeks and ponds to large lakes and rivers with clear to moderately stained water (except when temporarily turbid after heavy rains). Usually this fish is found over mud, silt, or detritus in sluggish pools, in slow current near moderate flow in streams, or in slackwater side areas with moderate to abundant vegetation. It occurs also in tidal and slightly brackish water in the south (e.g., tidal freshwater marshes and beaches in Virginia) (Burkhead and Jenkins 1991). Spawning areas are in still shallow water near shore where vegetation is present (Scott and Crossman 1973).

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat Type: Freshwater

Comments: Habitat ranges from warm-water small creeks and ponds to large lakes and rivers with clear to moderately stained water (except when temporarily turbid after heavy rains). Usually this fish is found over mud, silt, or detritus in sluggish pools, in slow current near moderate flow in streams, or in slackwater side areas with moderate to abundant vegetation. It occurs also in tidal and slightly brackish water in the south (e.g., tidal freshwater marshes and beaches in Virginia) (Burkhead and Jenkins 1991). Spawning areas are in still shallow water near shore where vegetation is present (Scott and Crossman 1973).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

benthopelagic; freshwater
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Occurs in pond, lakes and sluggish mud-bottomed pools of creeks and small to medium rivers. Often found in vegetation.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Eats mostly small microcrustaceans and aquatic insects (mostly planktonic, also benthic and plant-associated). Detritus and living plant sometimes is taken in significant amounts. (Lee et al. 1980, Scott and Crossman 1973, Burkhead and Jenkins 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 - 300

Comments: This species is represented by a large number of occurrences (subpopulations and locations), but it is rare or no longer extant in many of these locations.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

Unknown

Comments: Total adult population size is unknown but presumably exceeds 10,000.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Reproduction

Spawns May to August in the north. In New Hampshire, spawning was observed in June at water temperatures of 14-27 C. In Pennsylvania, spawning occurred in June-July in a dry year, July-August in a cooler, wetter year (Finger 2001). In Virginia, spawning apparently occurs from mid-May through mid-June. Reportedly matures in one year, lives a little longer than two years at the most (Burkhead and Jenkins 1991). However, in Pennsylvania, Finger (2001) found that males did not appear to mature by age-1, and it was uncertain if females spawned at age-1; males lived to age-3 and females to age-4.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Notropis bifrenatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 11 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATTTAGTATTTGGTGCCTGGGCCGGAATAGTGGGAACTGCTCTAAGCCTCCTTATTCGAGCTGAACTAAGTCAACCTGGCTCACTCCTAGGTGATGACCAAATCTATAATGTTATTGTTACTGCTCACGCCTTTGTAATAATTTTCTTTATAGTAATGCCAATTCTTATTGGCGGATTCGGGAACTGACTTGTACCGCTAATGATCGGGGCACCTGATATAGCATTCCCACGAATAAACAACATGAGTTTTTGACTTTTACCTCCATCATTCCTATTACTATTAGCCTCTTCTGGAGTTGAGGCCGGGGCTGGAACAGGATGAACCGTCTATCCCCCACTTGCAGGTAACCTTGCCCATGCAGGAGCATCAGTAGATCTTACTATTTTCTCTCTCCATTTAGCAGGTGTATCATCAATTCTAGGAGCAGTTAATTTTATTACCACAATTATTAACATGAAACCTCCAGCAATCTCTCAATACCAAACACCCCTCTTCGTGTGAGCTGTACTTGTAACTGCCGTTCTTCTACTCCTATCACTACCTGTCCTAGCTGCTGGAATTACTATACTTCTAACTGACCGTAACCTAAATACTACATTCTTTGACCCGGCAGGGGGAGGTGATCCCATCCTATATCAACATTTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Notropis bifrenatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 11
Specimens with Barcodes: 27
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2014

Assessor/s
NatureServe

Reviewer/s
Smith, K. & Darwall, W.R.T.

Contributor/s
Hammerson, G.A.

Justification
This species is listed as Least Concern because although distribution and abundance appear to be widely declining, the rate of decline may be less than 30 percent over 10 years or three generations, and the species still has a wide range and occurs in a fairly large number of locations. Population size is unknown but presumably exceeds 10,000.

History
  • 2010
    Near Threatened (NT)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N3 - Vulnerable

United States

Rounded National Status Rank: N3 - Vulnerable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G3 - Vulnerable

Reasons: Widely distributed in streams primarily in northeastern North America, but abundance and area of occupancy have declined greatly in recent decades; causes of the decline include degraded habitat and unknown factors. As of 2012, many state ranks (SRANKs) were out of date.

Intrinsic Vulnerability: Moderately vulnerable

Other Considerations: New Jersey is currently conducting a status review of nongame fishes using the Delphi process, which relies heavily upon expert opinion and group concensus. As of early 2004, they were in Round 3 of the process and expected results within a few months. Judging from the opinions and ranks received so far, bridle shiner will most likely receive a state status of either special concern or threatened, but this is preliminary. Once the Delphi results are approved by the Endangered and Nongame Species Advisiory Committee, they will go through the state rule making process to have the appropriate fish species added to the E & T list. It appears as though there is enough supporting evidence to change the current Heritage ranking in New Jersey to either S2 or S3 (J. Bowers-Altman, pers. comm., 2004). Similarly, the state rank in NY likely will change to S2 or S3 once a review of the status has been completed (P. Novak, pers. comm., 2004).

In Rhode Island, a review of information in the early 1980s found the bridle shiner in only one of the state's watersheds (Pawcatuck). Even if the status has remained unchanged, the state rank likely would not be any better than S2 (R. Enser, pers. comm., 2004).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is represented by a large number of occurrences (subpopulations and locations), but it is rare or no longer extant in many of these locations.

Total adult population size is unknown but presumably exceeds 10,000.

This species has undergone a range-wide decline in abundance, number of subpopulations, and area of occupancy. For example, it has been found recently in only one of 31 historical locations in Pennsylvania (Argent et al. 1997, Finger 2001) and in a small percentage of several dozen historical locations in Massachusetts (Hartel et al. 2002).

Currently, area of occupancy, number of subpopulations, and abundance appear to be widely declining, but up-to-date information is lacking for many areas. This species was categorized as "vulnerable" by Jelks et al. (2008).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Decline of 10-30%

Comments: Currently, area of occupancy, number of subpopulations, and abundance appear to be widely declining, but up-to-date information is lacking for many areas. This species was categorized as "vulnerable" by Jelks et al. (2008).

Global Long Term Trend: Decline of 30-70%

Comments: This species has undergone a range-wide decline in abundance, number of subpopulations, and area of occupancy. For example, it has been found recently in only 1 of 31 historical locations in Pennsylvania (Argent et al. 1997, Finger 2001) and in a small percentage of several dozen historical locations in Massachusetts (Hartel et al. 2002).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Threats include factors that degrade or destroy the required vegetated waters or increase water turbidity (these fishes are visual predators). Agricultural pollution also may negatively impact the habitat (Burkhead and Jenkins 1991). Introduced piscivorus fishes may reduce or eliminate populations where aquatic vegetation has been removed. Causes of decline are unknown in some areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Degree of Threat: Very high - high

Comments: Threats include factors that degrade or destroy the required vegetated waters or increase water turbidity (these fishes are visual predators). Agricultural pollution also may negatively impact the habitat (Burkhead and Jenkins 1991). Introduced piscivorus fishes may reduce or eliminate populations where aquatic vegetation has been removed. Causes of decline are unknown in some areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Near Threatened (NT)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
More information is needed about current status throughout the range and the causes of decline.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biological Research Needs: Investigate causes of the decline.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Bridle shiner

The bridle shiner (Notropis bifrenatus) is a member of the minnow family (Cyprinidae). This species has been identified as being of Special Concern by the Committee on the Status of Endangered Wildlife in Canada (COSEWIC).

Distribution[edit]

The bridle shiner is found in eastern North America, from eastern Lake Ontario, east to Maine, and south to South Carolina. In Ontario, it is found in lowland areas in the eastern Lake Ontario drainage and the Saint Lawrence River. The most stable population is found around the Thousand Islands.

Characteristics[edit]

  • Small, slender body; somewhat compressed laterally
  • Average adult length of 50 mm
  • Snout length usually smaller than eye diameter
  • Small, angular, terminal mouth
  • Large scales; lateral line incomplete
  • Straw-coloured, silvery dorsal side with a green-blue iridescence and silvery-white on ventral side
  • Prominent black lateral band from tail to snout
  • Males develop minute nuptial tubercles on the head, nape and pectoral fin

Habitat and life history[edit]

The bridle shiner is found in quiet areas of streams and occasionally in lakes. It is usually associated with abundant submersed aquatic vegetation and a river bottom composed of silt and sometimes sand. It uses the vegetation for protection, feeding, and spawning. It has been found in moderately turbid water, but prefers clear water.

Diet[edit]

The bridle shiner mainly feeds on zooplankton and aquatic insect larvae such as chironomids. Plant materials make up a small portion of its diet.

Threats[edit]

Like all members of the minnow family, they can be prey for larger fish species such as northern pike, smallmouth bass, and yellow perch.

This species is vulnerable to poor water quality and high turbidity, particularly in agricultural areas. In areas where zebra mussels have invaded, the improved water clarity may benefit this species.[citation needed] The densely growing Eurasian watermilfoil aquatic plant hinders spawning areas for the minnow and may contribute to its decline.

Similar species[edit]

The sand shiner (Notropis stramineus) and mimic shiner (Notropis volucellus) are similar, but lack a prominent lateral band. The bridle shiner is very similar to other black-lined shiners, including the pugnose shiner (Notropis anogenus), blackchin shiner (Notropis heterodon) and blacknose shiner (Notropis heterolepis). The bridle shiner can be distinguished from pugnose and blackchin shiners by the lack of pigment on the lower jaw. Blacknose shiners also lack this pigment, but have a more subterminal mouth as well as eight anal rays: bridles typically have seven.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!