Overview

Brief Summary

Hemigrapsus nudus

Hemigrapsus nudus (Varunidae), commonly known as the purple shore crab, is found along the Pacific coast of North America, ranging from Yacobi Island, Alaska to Bahia de Tortuga, California (Oliver and Schmelter 1997). Hemigrapus nudus typically inhabits the rocky shore areas of the mid to low intertidal zones, preferring locations with larger rocks and stones overlaying sand. These areas provide an abundance of shelter and allow for more adequate drainage of water (Kundsen 1964; McGaw 2003). Purple shore crabs prefer water temperature ranges from 14.6 °C to 26.9 °C. Their preferred salinity ranges between 22 PSU and 32 PSU, but H. nudus will tolerate lower salinities in order to find shelter (McGraw 2001, McGraw 2003). Hemigrapsus nudus is typically purple in color, but individuals can vary from greenish-yellow to reddish-brown. Purple shore crabs are characterized by the reddish-purple spots located on their claws and the lack of hair on their legs. The shell, or carapace, of males can measure up to 36.2 mm wide, while the carapace of females can measure up to 34 mm wide (Oliver and Schmelter 1997). Mating occurs annually, generally beginning in November and extending into early April, with eggs hatching from May to early June. The number of offspring produced by a female is positively correlated with her size. Females can lay from 441 to 36,400 eggs at a time; on average, females lay around 13,000 eggs (Kundsen 1964, Oliver and Schmelter 1997). Purple shore crabs are considered to be omnivorous with a diet consisting mainly of diatoms, desmids, and green algae. They are also known to occasionally eat small animals such as snails and barnacles and consume dead organic matter (Kundsen 1964, Lewis et al. 2007, Oliver and Schmelter 1997).

  • Knudsen, J. W. (1964). Observations of the reproductive cycles and ecology of the common Brachyura and crablike Anomura of Puget Sound, Washington. Pacific Science 18(3): 3- 33.
  • Lewis, T., M. Mews, D. E. Jelinski, and M. Zimmer. (2007). Detrital subsidy to the supratidal zone provides feeding habitat for intertidal crabs. Estuaries and Coasts 30: 451-458.
  • McGaw, I. J. (2001). Impacts of habitat complexity on physiology: Purple Shore Crabs tolerate osmotic stress for shelter. Estuarine, Coastal and Shelf Science 53: 865–876.
  • McGaw, I. J. (2003). Behavioral thermoregulation in Hemigrapsus nudus, the amphibious purple shore crab. The Biological Bulletin 204: 38-49.
  • Oliver, J. and A. Schmelter. (1997). Life history of the native shore crabs Hemigrapsus oregonensis and Hemigrapsus nudus and their distribution, relative abundance and size frequency distribution at four sites in Yaquina Bay, Oregon. Oregon State University. http://people.oregonstate.edu/~yamadas/crab/ch5.htm
translation missing: en.license_cc_by_nc_4_0

© Aubrey Kent

Supplier: Aubrey Kent

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Biology/Natural History: Does not live in burrows, as Hemigrapsus oregonensis often does. The chela of males, as of H. oregonensis and P. crassipes, have a prominent tuft of hairlike setae on the palm. This species is an osmoregulator and can tolerate both hypo- and hyperosmotic conditions. In Puget Sound feeds on diatoms, desmids, and small Ulva and Enteromorpha green algae scraped from rocks with the tips of the chelae. May also feed on a few animal products, such as amphipods and the eggs of Nucella emarginata and other whelks. In Puget Sound, females carrying eggs are found from January to mid-July; especially in April. Female may carry from 400 to 36,000 eggs. This species sometimes has the pasasitic isopod Portunion conformis in the perivisceral cavity, and the eggs may be attacked by the tiny Nemertean worm Carcinonemertes epialti. Predators include gulls white-winged scoters, Anthopleura anemones, and staghorn and tidepool sculpins. Nucella lamellosa seems to be attracted to the scent of this crab but is not known to be a predator.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

This shore crab has no transverse lines on the carapace and 3 teeth at the anterolateral margin. Its chelipeds have prominent purple spots and white tips. Its legs are not covered with abundant setae. It is usually purple but may be olive green or redish-brown. Males up to 5.6 cm carapace width, females up to 3.4 cm.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Geographical Range: Yakobi Island, Alaska to Bahia de Tortuga, Mexico. Uncommon below central CA.

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Look Alikes

How to Distinguish from Similar Species: Hemigrapsus oregonensis also has 3 anterolateral teeth but no purple spots on the chelipeds and the legs have abundant setae. Pachygrapsus crassipes (Oregon and south) has transverse lines and 2 anterolateral teeth on the carapace.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 79 specimens in 1 taxon.
Water temperature and chemistry ranges based on 63 samples.

Environmental ranges
  Depth range (m): 0 - 5
  Temperature range (°C): 10.119 - 10.345
  Nitrate (umol/L): 5.774 - 6.931
  Salinity (PPS): 31.692 - 32.059
  Oxygen (ml/l): 6.535 - 6.616
  Phosphate (umol/l): 0.883 - 0.974
  Silicate (umol/l): 12.975 - 16.001

Graphical representation

Depth range (m): 0 - 5

Temperature range (°C): 10.119 - 10.345

Nitrate (umol/L): 5.774 - 6.931

Salinity (PPS): 31.692 - 32.059

Oxygen (ml/l): 6.535 - 6.616

Phosphate (umol/l): 0.883 - 0.974

Silicate (umol/l): 12.975 - 16.001
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 79 specimens in 1 taxon.
Water temperature and chemistry ranges based on 63 samples.

Environmental ranges
  Depth range (m): 0 - 5
  Temperature range (°C): 10.119 - 10.345
  Nitrate (umol/L): 5.774 - 6.931
  Salinity (PPS): 31.692 - 32.059
  Oxygen (ml/l): 6.535 - 6.616
  Phosphate (umol/l): 0.883 - 0.974
  Silicate (umol/l): 12.975 - 16.001

Graphical representation

Depth range (m): 0 - 5

Temperature range (°C): 10.119 - 10.345

Nitrate (umol/L): 5.774 - 6.931

Salinity (PPS): 31.692 - 32.059

Oxygen (ml/l): 6.535 - 6.616

Phosphate (umol/l): 0.883 - 0.974

Silicate (umol/l): 12.975 - 16.001
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth Range: Mostly intertidal

Habitat: Under rocks and in cracks. Also high in some estuaries.

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Hemigrapsus nudus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

GGAGGATTTGGAAATTGATTAGTTCCACTAATACTAGGGGCGCCAGACATAGCATTCCCTCGTATAAACAATATAAGATTTTGGCTTTTACCGCCCTCTTTATCCCTTCTTTTAACAAGAAGAATAGTAGAGAGTGGAGTTGGCACAGGGTGAACTGTTTACCCTCCCCTCTCCGCTGCTATTGCCCACGCTGGCGCCTCTGTCGATCTCGGGATTTTCTCACTACATCTTGCAGGGGTCTCTTCAATTTTAGGAGCAGTAAATTTTATAACTACCGTTATTAATATACGATCTTACGGGAGGACAATGGACCAAATACCTCTTTTTGTGTGAGCTGTATTCATTACTGCTATTCTCTTACTTTTATCTCTTCCAGTTCTAGCAGGTGCTATCACTATGTTGCTTACTGATCGAAATTTAAATACATCTTTCTTTGACCCTGCTGGCGNGGGGGGACCAGTTTTATACCAACATTTATTTTGGTTCTTTGGTCATCCTGAAGTTTATATTTTGATCTTACCTGCCTTCGGAATGATTTCTCATATTGTTAGTCAAGAATCTGGTAAAAAAGAATCTTTTGGTACTTTGGGTATGATTTATGCTATACTAGCCATTGGAATTTTAGGATTTGTAGTATGAGCTCACCATATATTTACATTGGGAATAGACGTAGACACTCGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Hemigrapsus nudus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 18
Specimens with Barcodes: 26
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Purple shore crab

The purple shore crab, Hemigrapsus nudus, is a common crab of the family Varunidae. It can be found sheltering under rocks in inter-tidal areas along the west coast of North America, from Alaska to Baja California in Mexico.[1] This crab primarily eats sea lettuce and other green algae, and occasionally scavenges dead animals.[2]

Description[edit source | edit]

A small crab, H. nudus reaches sizes of approximately 4.0–5.6 centimetres (1.6–2.2 in).[1] Its dorsal shell (carapace) is generally a dark purple in color, although it may be olive green or red, with white or cream markings. The color of the legs matches the color of the carapace but the white-tipped claws (chelipeds) are a lighter color with purple or red spots – these spots allow H. nudus to be distinguished from a similar looking crab, the lined shore crab, Pachygrapsus crassipes, whose chelipeds lack spots.[3] The legs of H. nudus lack setae, a distinguishing feature of the otherwise similar H. oregonensis.

References[edit source | edit]

  1. ^ a b Kwasi Addae. "Hemigrapsus nudus". The Evergreen State College. Retrieved November 4, 2010. 
  2. ^ "Hemigrapsus nudus The Purple Shore Crab". Intertidal Marine Invertebrates of the South Puget Sound. Retrieved November 4, 2010. 
  3. ^ James Watanabe (March 11, 2010). "Phylum Arthropoda, Subph. Crustacea: Rocky Shore Crabs, Shrimp, Isopods, Amphipods". SeaNet: Common Marine Organisms of Monterey Bay, California. Stanford University. Retrieved November 4, 2010. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!