Articles on this page are available in 1 other language: Chinese (Simplified) (12) (learn more)

Overview

Brief Summary

Biology

This species is wary, although not shy (1), and a high perch is normally occupied whilst singing (1). The female builds the nest, which consists of a cup of grasses and moss with a lining of hair or very fine grasses (6). Between 2 to 6 eggs are laid per clutch, and incubation takes 12 to 14 days (8). In winter, yellowhammers form flocks, often in mixed species groups with other seed-eating birds (11). They feed mainly on cereals and large grass seeds as well as the seeds of docks and other plants, which they typically pick from the ground (5). They may also perch on cereal stems to obtain grains during autumn (5). Towards the evening, flocks fly to roost in scrubby or marshy areas (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

The yellowhammer is one of the brightest coloured of our native birds (3). It is a fairly large bunting, with a long tail, white outer tail feathers, a rust-coloured rump and yellowish plumage. In summer, males develop striking breeding colours; the head and underparts become bright yellow, with olive green or red-brown flecks to the breast (1). Females and juveniles are generally duller in colour, with grey or black streaks on the breast and sides (1). The song of the yellowhammer consists of rapidly repeated notes, and has earned the species the local names of 'a little-bit-of-bread-and- no-cheese' in parts of England, and 'may-the-Devil-take-you' in Scotland; both of which are imitative of the song (3). Yet more local names including 'scribbler' and 'writing lark' refer to the eggs, which are usually covered in dark squiggly lines resembling scrawled handwriting (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range

Widespread and common throughout much of Europe, the yellowhammer is a resident species in the UK (present throughout the year), and has a more restricted distribution in Scotland than the rest of the British Isles (4). Some of the Scandinavian population migrate in small numbers to the British Isles during winter (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 2 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 10.632 - 10.632
  Nitrate (umol/L): 12.829 - 12.829
  Salinity (PPS): 32.748 - 32.748
  Oxygen (ml/l): 6.507 - 6.507
  Phosphate (umol/l): 0.734 - 0.734
  Silicate (umol/l): 8.436 - 8.436
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 2 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 10.632 - 10.632
  Nitrate (umol/L): 12.829 - 12.829
  Salinity (PPS): 32.748 - 32.748
  Oxygen (ml/l): 6.507 - 6.507
  Phosphate (umol/l): 0.734 - 0.734
  Silicate (umol/l): 8.436 - 8.436
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Seems to prefer farmland, particularly bushy areas, as well as the edges of woodlands, wooded pasture, and heaths (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 13 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Emberiza citrinella

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 10 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTTCTCCAACCACAAAGACATTGGCACTCTATACCTGATTTTCGGTGCATGAGCCGGAATGGTAGGTACCGCCTTAAGCCTCCTCATCCGAGCAGAACTAGGCCAACCCGGAGCCCTCCTGGGAGACGACCAAGTCTACAACGTAGTCGTCACAGCCCACGCTTTCGTAATAATCTTCTTCATAGTTATACCAATNATGATCGGAGGGTTCGGAAACTGACTCGTCCCCCTAATAATCGGAGCCCCAGACATAGCATTCCCACGGATAAACAACATAAGCTTCTGACTACTCCCCCCATCCTTCCTGCTACTACTAGCATCTTCTACTGTAGAAGCNGGCGTAGGAACAGGCTGAACAGTGTACCCCCCACTAGCCGGAAACCTAGCCCATGCCGGAGCTTCGGTCGACCTCGCAATCTTCTCCCTTCACCTAGCCGGTATCTCTTCAATCCTGGGGGCAATCAACTTCATCACTACAGCAATCAACATAAAACCACCTGCCCTCTCACAATACCAAACCCCTCTATTCGTCTGATCAGTCTTAATTACCGCAGTCCTCCTGCTCCTGTCCCTCCCAGTCCTTGCCGCCGGCATTACAATACTACTCACGGACCGTAACCTTAACACCACATTCTTCGACCCTGCTGGAGGAGGAGACCCCGTCCTATACCAACATCTCTTCTGATTCTTCGGCCACCCAGAAGTCTACATCTTAATTCTCCCAGGATTTGGAATTATCTCCCACGTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Emberiza citrinella

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 18
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2014

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2012
    Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5