Articles on this page are available in 1 other language: Spanish (7) (learn more)

Overview

Brief Summary

Sphyrapicus varius

A medium-sized (8-9 inches) woodpecker, the male Yellow-bellied Sapsucker is most easily identified by its black-and-white barred back, buff breast, and red forehead and throat. Female Yellow-bellied Sapsuckers are similar to males, but have a white throat. In flight, this species may be separated from other small, dark-headed woodpeckers in its range by its conspicuous white wing patches. The Yellow-bellied Sapsucker breeds across south-central Canada and the northeastern United States. Isolated breeding populations exist at higher elevations in the Appalachian Mountains as far south as North Carolina. This species migrates south for the winter, when it may be found from the Mid-Atlantic region and the southeast south through the West Indies, Mexico, and Central America. Yellow-bellied Sapsuckers breed in a number of northern mixed evergreen-deciduous forest types. In winter, this species may be found in a variety of temperate and tropical woodland habitats. Yellow-bellied Sapsuckers may eat fruits, berries, and insects at certain times of the year, but this species is best known for its preference for tree sap collected from holes drilled in tree trunks. In appropriate habitat, Yellow-bellied Sapsuckers may be observed climbing up tree trunks while foraging (or drilling) for food. Good birdwatchers are quick to notice trees with grids of small holes ringing the trunks, as these are likely sapsucker feeding sites. Yellow-bellied Sapsuckers are primarily active during the day.

Threat Status: Least Concern

  • Peterson, Roger Tory. Birds of Eastern and Central North America. Boston: Houghton Mifflin, 1980. Print.
  • Sphyrapicus varius. Xeno-canto. Xeno-canto Foundation, n.d. Web. 20 July 2012. .
  • Walters, Eric L., Edward H. Miller and Peter E. Lowther. 2002. Yellow-bellied Sapsucker (Sphyrapicus varius), The Birds of North America Online (A. Poole, Ed.). Ithaca: Cornell Lab of Ornithology; Retrieved from the Birds of North America Online: http://bna.birds.cornell.edu/bna/species/662
  • Yellow-bellied Sapsucker (Sphyrapicus varius). The Internet Bird Collection. Lynx Edicions, n.d. Web. 20 July 2012. .
  • eBird Range Map - Yellow-bellied Sapsucker. eBird. Cornell Lab of Ornithology, N.d. Web. 20 July 2012. .
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Institution

Supplier: DC Birds

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

The range of Sphyrapicus varius is North and Middle America. It is common to see this bird wintering in the southern United States, Central America, and the West Indies. Some birds stay within the transition zones, but most of them winter in the southern United States, Central America, and the West Indies.

(Bent 1992, Winkler et al. 1995)

Biogeographic Regions: nearctic (Native ); neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: BREEDS: extreme eastern Alaska, southwestern Yukon, southwestern Mackenzie, northwestern and central Saskatchewan, central Manitoba, north-central Ontario, southern Quebec (including Anticosti Island), southern Labrador, and central Newfoundland south to northeastern British Columbia, central Alberta, central and southeastern Saskatchewan, eastern North Dakota, eastern South Dakota, Iowa, northeastern Missouri, central Illinois, northwestern Indiana, northern Ohio, western Pennsylvania, northwestern Connecticut, western Massachusetts, and New Hampshire; locally in Appalachian Mountains south to eastern Tennessee and western North Carolina (AOU 1983). WINTERS: Missouri, Illinois, Indiana, Ohio Valley, and New Jersey (rarely farther north) south through Texas, southeastern U.S., Middle America (except northwestern Mexico north of Sinaloa and west of Coahuila), Bahamas, and Antilles (south to Dominica, but rare east of Hispaniola and Netherlands Antilles). Casual or accidental in south-coastal Alaska, California, Arizona, New Mexico, Colorado, Wyoming, Bermuda, and Greenland.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

N America (Yukon, Canada, US); winters se US to Panama.
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

The male has a red forecrown on a black and white head and a red throat. Sexual dimorphism between the adults is easily observed as the female has a white chin compared to the red in the male. The back is blackish, with a white rump, and a large white wing patch. The underparts are yellowish and are paler in females. Juvenile woodpeckers retain a brown plumage until late in the winter when it begins to take on the colors of its sex.

(Short 1982)

Range mass: 43 to 55 g.

Other Physical Features: endothermic ; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 22 cm

Weight: 50 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Sphyrapicus varius
Catalog Number: USNM 457935
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds
Sex/Stage: Male; Adult
Preparation: Skin: Whole
Collector(s): A. Ganier
Year Collected: 1946
Locality: Unicoi Mountains, Stratton Gap, Monroe, Tennessee, United States, North America
Elevation (m): 1326
  • Type: Ganier. October 22, 1954. Migrant. 25 (3): 40, pl.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Sphyrapicus varius
Catalog Number: USNM 457935
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds
Sex/Stage: Male; Adult
Preparation: Skin: Whole
Collector(s): A. Ganier
Year Collected: 1946
Locality: Unicoi Mountains, Stratton Gap, Monroe, Tennessee, United States, North America
Elevation (m): 1326
  • Type: Ganier. October 22, 1954. Migrant. 25 (3): 40, pl.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

They live in northern deciduous and mixed coniferous forests in summer. During winter they live in forests and various semi-open habitats.

(Winkler et al. 1995)

Terrestrial Biomes: forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Deciduous or mixed deciduous-coniferous forest; in migration and winter also in a variety of forest and open woodland habitats, parks, orchards (AOU 1983). Nest hole is bored by both sexes; usually located 3-14 m above ground. Generally excavates a new hole each year. See Mitchell (1988) for specifications for the construction and placement of nest boxes.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Withdraws southward from most of breeding range in winter. Females tend to winter farther south than do males.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

The main food source is insects. The most common are beetles, ants, moths and dragonflies. When insects are not abundant, sap is an important food source. Sphyapicus varius gets its sap from poplar, willow, birch, maple, hickory, pine, spruce and fir trees. Other sources of food taken from October to February include berries and fruits.

(Bent 1992, Winkler et al. 1995)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Drills holes in coniferous and deciduous trees and laps up sap and insects with tongue. Eats ants, wasps, mayflies, moths, spruce budworms, and beetles, etc. (Terres 1980). Also feeds on fruit, aspen buds, and suet.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Primarily a solitary species, but loose groups may be seen during migration (Oberholser 1974).

Presence of sapsuckers influences the structure of local bird communities (e.g., through cavity excavation), and sapwells made by these birds enhance local insect abundance and diversity (Rissler et al. 1995, Wilson Bull. 107:746-752).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

The breeding call for these birds sound like a kwee-urk. This same call is also a territorial call.

"Quirks" are used to strengthen the pairbond between two birds of the opposite sex. This is a scratching on the tree and usually happens along with head bobbing.

Week, week; wurp, wurp noises are exchanged between pairs and/or with their juveniles when they meet.

When in the presence of a predator the birds give a repeated shrill. When they are just mildly excited, they have been known to give a mewing c-waan noise.

Communication Channels: visual ; acoustic

Perception Channels: visual ; tactile ; acoustic ; chemical

  • Kilham, L. 1983. Life History Studies of Woodpeckers of Eastern North America. Cambridge, Massachusetts: Club Publishing.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Average lifespan

Status: wild:
81 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 6.8 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

In late April and May nests are excavated in live birch and poplar trees 2-20 meters above ground. Both sexes participate in the excavation. At the site of excavation, courtship flights are executed between the pair; a "winnowing" sound is made during these flights. Other than ritual flights there is ritual tapping to strengthen pair bonds, this occurs when the male taps on the tree and the female responds with a similar tap. Copulation results in four to seven egg being laid. Incubation duties are shared by both adults and lasts for 12-13 days.. The male, however, spends more time on the eggs, especially at night.

 Young fledge within 25-29 days of hatching. The adults must feed their chicks nine times per hour to help them develop properly. To help in sanitation, the adults mix sawdust with the droppings and carry them out of the nest.

(Short 1982, Kilham 1983)

Key Reproductive Features: iteroparous ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Average time to hatching: 13 days.

Average eggs per season: 5.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Clutch size usually is 5-6, sometimes 4-7. Incubation, by both sexes, lasts 12-13 days. Nestlings are altricial. Young birds leave the nest-hole 25-29 days after hatching (Terres 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Sphyrapicus varius

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 10 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACCGATGATTATTTTCCACTAACCACAAAGACATTGGCACCCTATACCTTATCTTCGGCGCATGAGCCGGTATAATCGGCACAGCCCTCAGCCTCCTCATTCGTGCTGAACTAGGCCAGCCCGGTACTCTCCTTGGTGAC---GACCAAATCTACAATGTAATTGTCACTGCTCATGCATTCGTAATAATCTTCTTCATAGTTATACCNNTCATAATTGGAGGGTTCGGAAACTGACTAGTACCCCTCATGATTGGAGCCCCCGACATAGCATTCCCCCGAATAAATAACATAAGCTTCTGACTCCTCCCCCCATCATTTCTTCTTCTTCTAGCCTCCTCAACAGTAGAAGCAGGGGCTGGAACAGGCTGAACTGTCTACCCACCTCTCGCTGGTAACCTAGCCCACGCAGGAGCCTCAGTAGACCTGGCCATCTTCTCCCTCCACCTAGCAGGCATTTCGTCCATCTTAGGGGCGATTAACTTCATCACAACAGCCATCAACATAAAACCACCAGCTATTTCACAATACCAAACCCCCCTATTTGTCTGATCAGTCCTCATCACCGCCGTCCTACTACTCCTATCTCTACCAGTTCTAGCTGCAGGGATCACAATACTCCTTACAGACCGCAACCTAAACACTACATTCTTTGACCCCGCTGGCGGAGGCGACCCAATCCTTTACCAACATCTTTTCTGATTCTTTGGCCACCCCGAAGTCTACATCCTAATTCTTCCAGGATTCGGCATCATCTCCCACGTAGTAACGTACTACACTAGCAAAAAAGAACCCTTCGGTTACATAGGCATAGTATGAGCCATACTCTCCATTGGGTTCCTAGGCTTTATCGTATGAGCCCACCACATATTCACCGTAGGAATAGACGTAGACACACGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Sphyrapicus varius

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 11
Specimens with Barcodes: 14
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5