Articles on this page are available in 1 other language: Chinese (Simplified) (6) (learn more)

Overview

Distribution

Bar-headed geese (Anser indicus) have a breeding range that stretches from Mongolia south through Russia and Western China to Tibet and as far west as Kyrgyzstan. Approximately 25% of the global population of bar-headed geese winter on the southern Tibetan-Qinghai Plateau. Another wintering area for a portion of the population is India and Bangladesh.

Biogeographic Regions: palearctic (Native ); oriental (Native )

  • Guo-Gang, Z., L. Dong-Ping, H. Yun-Qiu, J. Hong-Xing, D. Ming, Q. Fa-Wen, L. Jun, X. Zhi, L. Feng-Shan. 2011. Migration Routes and Stop-Over Sites Determined with Satellite Tracking of Bar-Headed Geese Anser indicus Breeding at Qinghai Lake, China. Waterbirds, 34(1): 112-116. Accessed August 05, 2012 at http://www.bioone.org/doi/full/10.1675/063.034.0115.
  • Takekawa, J., S. Heath, D. Douglas, W. Perry, Javed Salim, S. Newman. 2009. Geographic variation in Bar-headed Geese Anser indicus: connectivity of wintering areas and breeding grounds across a broad front. Wildfowl, 59: 100-123. Accessed August 05, 2012 at https://www.wwt.org.uk/userfiles/files/11_Takekawa_pp100_123.pdf.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Alpine lakes in central Asia; winters to India and Myanmar.
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Bar-headed geese have grey bodies, with orange legs and a black and white neck. This species is named for the obvious black U-shaped bars on the back of the white head. They weigh between 2 and 3 kg (4.5 and 6.5 lbs) with a wingspan between 140 and 160 cm (55 and 62 inch), and are between 68 and 78 cm (27 and 30 inch) in length. Bar-headed geese have a basal metabolic rate of 756 cubic centimeters of oxygen per hour.

Range mass: 2.0 to 3.0 kg.

Range length: 68 to 78 cm.

Range wingspan: 140 to 160 cm.

Average basal metabolic rate: 756 cm3.O2/g/hr.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike

  • Tammelin, H. 2012. "Bar-headed Goose" (On-line). NatureGate. Accessed August 09, 2012 at http://www.luontoportti.com/suomi/en/tekijat/.
  • Ward, S., C. Bishop, A. Woakes, P. Butler. 2002. Heart rate and the rate of oxygen consumption of flying and walking barnacle geese (Branta leucopsis) and bar-headed geese (Anser indicus). The Journal of Experimental Biology, 205: 3347–3356.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Bar-headed geese can be found at high elevations. They use habitats like mountain grasslands and crop fields from surrounding villages. Bar-headed geese tend to use freshwater marshes, lakes, and streams that are around elevations of 4,000 to 6,000 meters above sea level as stop-over and over-wintering sites. Some geese have even been reported to migrate at altitudes of 9,000 meters when they cross the Himalaya Mountains.

Range elevation: Sea Level to 6,000 m.

Habitat Regions: temperate ; terrestrial ; freshwater

Terrestrial Biomes: savanna or grassland

Aquatic Biomes: lakes and ponds; rivers and streams; brackish water

Wetlands: marsh

Other Habitat Features: agricultural

  • Middleton, B. 1992. Habitat and Food Preferences of Greylag and Barheaded Geese Wintering in the Keoladeo National Park, India. Journal of Tropical Ecology, 8 No.2: 181-193. Accessed August 05, 2012 at http://www.jstor.org/stable/2559700.
  • Scott, G., S. Egginton, J. Richards, W. Milsom. 2009. Evolution of muscle phenotype for extreme high altitude flight in the bar-headed goose. Proc Biol Sci, 276(1673): 3645-3653.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Bar-headed geese generally feed on the highland grasses surrounding their lakes and streams where they nest. During other times of the year they can be found eating on agricultural crops such as corn, wheat, barley, and rice.

Animal Foods: fish; insects

Plant Foods: leaves; roots and tubers; seeds, grains, and nuts

Primary Diet: herbivore (Folivore , Granivore )

  • Akbar, M., R. Khan, S. Mehboob, Z. Nisa. 2005. Wildlife of Border Belt Game Reserve District Narowal, Punjab, Pakistan. Pak. j. life soc. sci., 3(1-2): 13-17.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

These geese are prey for animals such as red foxes, and golden eagles. Some can also be parasites by using higher ranked females as hosts to raise their offspring. In addition they are also carriers of the H5N1 virus and capable of passing the virus to humans, and other animals as well. They assist in the dispersal of grass seeds they eat throughout the year.

Ecosystem Impact: disperses seeds

  • Cui, P., Y. Hou, a. et.. 2011. Bird Migration and Risk for H5N1 Transsmission into Qinghai Lake, China. Vector Bome Zoonotic Dis., 11(5): 567-576. Accessed August 09, 2012 at http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3096498/?tool=pmcentrez.
  • Weigmann, C., J. Lamprecht. 1991. Intraspecific nest parasitism in bar-headed geese, Anser indicus. Animal Behaviour, 41: 677-688.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

From the air the bar-headed geese are prey for sea eagles, golden eagles, crows, and ravens. On the ground the geese are preyed upon by red foxes. Some of the adaptations the geese have developed is the ability to survive at high altitudes. This limits the amount of ground predators that can reach them. They can survive at high altitudes because they have a higher density of capillaries that are spaced closer together this allows them to deliver more oxygen to their muscles, in particular their flight muscles. In addition to their capillaries they also have hemoglobin in their blood that is more efficient at taking in oxygen. Another adaptation is that these geese tend to live in large colonies or smaller family groups which enhances predator detection.

Known Predators:

  • red foxes (Vulpes vulpes)
  • crows (Corvus americanus)
  • ravens (Corvus corax)
  • sea eagles (Haliaeetus species)
  • golden eagles (Aquila chrysaetos)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Like most geese, bar-headed geese fly in "V"-shaped formations. When the lead bird gets tired they fall to the back of the formation and another goose takes the lead. The formation can vary from a traditional V to other shapes like "J"-shape and the echeleon shape where one arm of the "V"-shape is missing. The benefit of this style of flight is that each individual flies with reduced drag, which in turn saves them energy. They use vocal communications and visual cues to maintain their spacing while flying in these formations. This also assists them in staying in closely related family groups as they move from traditional feeding and breeding areas. Like other waterfowl they can also see in the ultraviolet spectrum of light.

Communication Channels: visual ; tactile ; acoustic

Perception Channels: visual ; ultraviolet; tactile ; acoustic ; chemical ; magnetic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Little information is published on the lifespan of bar-headed geese. Like most geese they are long-lived. A close relative, greylag geese, have a lifespan of 20 years in the wild and the oldest one in captivity lived 31 years.

Average lifespan

Status: wild:
20 years.

Average lifespan

Status: captivity:
20 years.

  • de Magalhaes, J., J. Costa. 2009. A database of vertebrate longevity records and their relation to other life-history traits.. Journal of Evolutionary Biology, 22(8): 1770-1774.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Bar-headed geese are seasonal breeders. They exhibit a monogamous mating system, where males pair with one single female for several years. During times when the population is biased towards females a polygynous system is adopted where a monogamous pair may be joined by multiple secondary females. These secondary females also breed with the male of the pair. Because they breed in large colonies, females defend their nests from socially lower females that may be using brood parasitism to increase the likely hood of their offspring's survival.

Mating System: monogamous ; polygynous

Bar-headed geese typically breed on an annual basis. This occurs during the spring. Nesting occurs from the last week of April until June. They typically lay 3 to 8 eggs on average. After 28 to 30 days the goslings hatch. There was little information on the birth mass of the goslings. They then fledge by 55 to 60 days, and reach sexual maturity at 3 years of age. Bar-headed geese tend to breed on the Tibetan-Qinghai Plateau. They lay their eggs in ground nests at high elevations in the highland marshes and lakes.

Breeding interval: Bar-headed geese breed annually (once yearly).

Breeding season: Bar-headed geese breed in the last week of April through July.

Range eggs per season: 3 to 8.

Range time to hatching: 28 to 30 days.

Range fledging age: 55 to 60 days.

Range time to independence: 55 to 60 days.

Average age at sexual or reproductive maturity (female): 3 years.

Average age at sexual or reproductive maturity (male): 3 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization ; oviparous

Bar-headed geese use biparental care when raising young. Studies show that male bar-headed geese are more alert and defensive when in the presence of their goslings. These same studies show that the goslings have the added benefit of an increased survival rate from having both parents. Both parents provide their goslings with protection from predators and other geese. In addition to that the parents also protect the goslings' food.

Parental Investment: precocial ; male parental care ; female parental care

  • Friedl, T. 1993. Intraclutch Egg-Mass Variation in Geese: Mechanism for Brood Reduction in Precocial Birds. The Auk, 110(1): 129-132. Accessed August 09, 2012 at http://library.unm.edu/sora/Auk/v110n01/p0129-p0132.pdf.
  • Lamprecht, J. 1987. Female Reproductive Strategies in Bar-headed Geese (Anser indicus): Why Are Geese Monogamous?. Behavioral Ecology and Socialbiology, 21(5): 297-305. Accessed August 06, 2012 at http://www.jstor.org/stable/4600095.
  • Prins, H., S. van Wieren. 2004. Number, population structure and habitat use of bar-headed geese Aniser indicus in Ladakh (India) during the brood-rearing period. Acta Zoologica Sinica, 50(5): 738-744.
  • Schneider, J., J. Lamprecht. 1990. The importance of biparental care in a precoial, monogamous bird, the bar-headed goose (Aniser indicus). Behavioral Ecology and Socialbiology, 27: 415-419. Accessed August 07, 2012 at http://www.jstor.org.ezproxy.uwsp.edu/stable/pdfplus/4600500.pdf.
  • Takekawa, J., S. Heath, D. Douglas, W. Perry, Javed Salim, S. Newman. 2009. Geographic variation in Bar-headed Geese Anser indicus: connectivity of wintering areas and breeding grounds across a broad front. Wildfowl, 59: 100-123. Accessed August 05, 2012 at https://www.wwt.org.uk/userfiles/files/11_Takekawa_pp100_123.pdf.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Anser indicus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CCACAAAGACATTGNCACCCTATACCTCATCTTCGGGGCATGAGCAGGAATAGTCGGCACCGCACTCAGCCTATTAATCCGCGCAGAACTAGGACAACCAGGAACTCTCCTAGGCGACGACCAAATTTACAATGTAATCGTTACCGCTCACGCCTTTGTAATAATCTTCTTTATAGTCATACCCATCATAATTGGAGGATTCGGCAACTGATTAGTCCCCCTCATAATCGGTGCCCCCGACATAGCATTCCCACGAATAAACAACATAAGCTTTTGACTCCTCCCCCCATCATTCCTCCTACTGCTAGCCTCATCCACTGTAGAAGCTGGCGCCGGCACAGGCTGAACTGTCTACCCTCCCCTAGCAGGTAACCTCGCCCACGCCGGAGCTTCAGTAGACCTGGCTATCTTCTCACTCCACTTAGCCGGTATCTCCTCCATCCTTGGAGCCATCAACTTTATCACCACAGCCATCAACATAAAACCCCCCGCACTCTCACAATACCAAACCCCACTATTTGTCTGATCCGTACTAATTACCGCCATCCTACTCCTTCTATCACTCCCCGTACTCGCCGCCGGTATTACAATATTACTAACTGACCGAAACCTAAACACCACATTCTTCGACCCCGCTGGAGGAGGAGACCCAATCCTGTACCAACACCTATTCTGATTCTTCGGACACCCAGAAGTCTATATCCTAATCCTACCAGGATTTGGA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Anser indicus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Near Threatened (NT)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5