Overview

Distribution

Range

Costa Rica to Brazil; Africa, Madagascar and Comoro Islands.
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Behaviour This species is subject to upredictable local nomadic movements (Johnsgard 1978) (usually of less than 500 km) in relation to variations in water and food availability (Madge and Burn 1988). Breeding commences at the start of the local rainy season (del Hoyo et al. 1992) with the species nesting individually (Langrand 1990, Hockey et al. 2005) or in loose colonies or small groups (del Hoyo et al. 1992). Adults undergo a post-breeding flightless moult period lasting for 18-25 days during which they are particularly vulnerable and seek the cover of densely vegetated wetlands (Kear 2005a). When not breeding the species is gregarious and may forage in flocks of up to several thousands of individuals (Kear 2005a). The species mainly forages at night (del Hoyo et al. 1992) (although it may also feed diurnally during the winter) (Madge and Burn 1988). Habitat The species inhabits a wide variety of freshwater wetlands (del Hoyo et al. 1992) including lakes, swamps (Kear 2005a), marshes, large rivers, river deltas, flood-plains (Madge and Burn 1988), reservoirs (Madge and Burn 1988, Kear 2005a), sewage farms (Africa) (Johnsgard 1978) and estuaries (Kear 2005a), and is commonly encountered feeding in rice fields (Kear 2005a). It shows a preference for wetlands in open country (del Hoyo et al. 1992) (although it is likely to inhabit fresh or brackish waters in more forested areas in South America) (Johnsgard 1978) with mud or sandbars for roosting and rich shoreline (Johnsgard 1978), emergent and surface vegetation (Brown et al. 1982). Adults require densely vegetated permanent wetlands for cover during their flightless post-breeding moult period (Hockey et al. 2005, Kear 2005a), although breeding birds prefer more ephemeral wetlands (Hockey et al. 2005). Diet Its diet consists of grasses (e.g. Echinochloa spp.), aquatic seeds e.g. of water-lilies Nyphaea and Nymphoides spp., rice (del Hoyo et al. 1992), pondweeds (e.g. Potamogeton spp.) (Hockey et al. 2005) and tubers (especially in the dry season) (Kear 2005a), as well as aquatic invertebrates such as molluscs, crustaceans and insects (del Hoyo et al. 1992), the consumption of which is highest during the rains (Kear 2005a). Breeding site The nest is a depression (Johnsgard 1978) or low construction of vegetation (Kear 2005a) placed over or at varying distances from water, usually in stands of dense vegetation (e.g. long grass, sedge or rice) (Kear 2005a) on dry ground or in reedbeds (Johnsgard 1978, del Hoyo et al. 1992), occasionally also in open crevices in trees (South America) (Madge and Burn 1988, Kear 2005a). The species may nest in solitary pairs (Langrand 1990, Hockey et al. 2005) with nests placed more then 75 m apart (Africa) (Brown et al. 1982, Hockey et al. 2005), although it may also nest in loose colonies or small groups (del Hoyo et al. 1992).

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 12 years (captivity) Observations: One specimen lived nearly 12 years at Woodland Park Zoo in Seattle (http://www.zoo.org/). Anecdotal evidence suggests these animals may live over 15 years in captivity, which is plausible even if unverified.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Dendrocygna viduata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TCTATACCTCATCTTCGGAGCATGAGCAGGAATAATCGGCACCGCACTTAGCTTGCTAATCCGTGCAGAACTGGGACAACCTGGAACTCTTCTAGGGGACGATCAAATCTACAACGTAATCGTCACGGCCCACGCTTTCGTAATAATCTTCTTCATAGTCATGCCCATCATAATTGGAGGCTTCGGAAACTGATTAGTTCCCCTGATAATCGGTGCCCCCGACATGGCATTTCCCCGAATAAACAACATAAGCTTCTGACTCCTACCACCATCATTCCTCCTTCTCCTGGCCTCATCCACTGTAGAAGCCGGTGCCGGCACAGGATGAACCGTATACCCACCCCTAGCAGGAAATCTAGCCCACGCTGGAGCATCAGTGGACCTAGCCATTTTCTCCCTCCATCTAGCTGGTATTTCCTCTATCCTAGGGGCCATTAACTTCATTACCACAGCCGTCAACATAAAACCACCTGCACTATCACAGTACCAAACCCCCCTATTCGTGTGGTCCGTCCTAATCACTGCCATCCTACTCCTCCTATCACTACCCGTACTTGCTGCCGGCATCACAATACTGCTAACAGACCGAAACCTAAATACTACATTCTTTGACCCAGCAGGAGGAGGAGACCCAATCCTGTACCAACACCTGTTCTGATTTTTCGGACATCCAGAGGTATACATCCTAATTTTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Dendrocygna viduata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5