Overview

Distribution

The northernmost distribution of Anhinga anhinga leucogaster is in the United States from North Carolina to Texas. It has however been spotted as far north as Wisconsin. Its range also includes Mexico, Central America, Panama, and Cuba. The individuals found in the more northern areas of the U.S. migrate there in March and April and stay until October, then return to Mexico and more southern parts of the U.S. Anhinga anhinga anhinga is found in South America from Colombia to Ecuador, east of the Andes to Argentina, and in Trinidad and Tobago. The range is limited by cool temperatures and low amounts of sunshine.

Biogeographic Regions: nearctic (Native ); neotropical (Native )

  • Hennemann, W. 1985. Energetics behavior and the zoogeography of *Anhinga anhinga* and double-crested cormorants *Phalacrocorax auritus*. Ornis Scand., 16(4): 319-323.
  • Isenring, R. 1997. By the Wayside. Passenger Pigeon, 59(4): 347-358.
  • del Hoyo, J., A. Elliot, J. Sargatal. 1992. Handbook of the Birds of the World. Vol. 1, Ostrich to Ducks.. Barcelona: Lynx Edicions.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) BREEDING: central and eastern Texas, southeastern Oklahoma, southern and eastern Arkansas, southern Missouri (formerly), western Tennessee, southern Illinois (formerly), north-central Mississippi, southern Alabama, southern Georgia, and coastal North Carolina south to southern Florida, Cuba, and Isle of Pines, and from Sinaloa and Gulf Coast south along both lowlands of Mexico and through Middle America and South America (also Tobago and Trinidad) west of Andes to Ecuador and east of Andes to eastern Peru, Bolivia, northern Argentina, and Uruguay (AOU 1983). NON-BREEDING: southeastern U.S. from central South Carolina, southern Georgia, Florida, and Gulf Coast southward; essentially resident in breeding range in Cuba, Isle of Pines, Middle America, and South America. Casual northward after breeding season (AOU 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Anhingas have an average body length of 85 cm, weight of 1350 g, wingspan of 117 cm, and bill length of 81 mm. The head is small and appears to be merely an extension of its long snake-like neck. In the neck, the 8th and 9th cervical vertebrae create a hinge-like apparatus that allows the quick catching of prey. The long, sharp, serrated bill also aids it in hunting. The wings are broad, allowing it to soar, and the feet are webbed to facilitate swimming. The physical structure of the legs is, however, more suited to crawling out of water onto land and for climbing bushes and trees. The tail is long and is used for providing lift, steering, braking, and balancing. When spread in flight, the tail resembles that of a turkey. The overall body shape of anhingas resembles that of a cormorant; the hunting action of the head and neck is more similar to a heron.

Anhingas are sexually dimorphic; males have brighter colors than females. Males have greenish-black plumage overall, accentuated by silver-gray feathers on the upper back and wings that are edged with long white plumes. They also have black crests. Females are brown with a lighter brown head and neck; juveniles are a uniform brown color. Molting of all flight feathers at the same time render them flightless for a while. Unlike some aquatic birds, all of the body feathers become completely wet upon contact with the water, allowing them to dive through the water more easily. This feature, however, causes them to have little buoyancy, to lose heat quickly, and hinders flight.

Average mass: 1350 g.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes colored or patterned differently

Average mass: 1080 g.

Average basal metabolic rate: 3.2258 W.

  • Hennemann, W. 1982. Energetics and spread-winged behavior of anhingas in Florida. Condor, 84(1): 91-96.
  • Scott, S. 1983. Field Guide to the Birds of North America. Washington D.C.: National Geographic Society.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 89 cm

Weight: 1235 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Anhinga anhinga prefers freshwater and coastal aquatic habitats that include shrub or tree-covered islands or shores; these habitats include lakes, marshes, swamps, mangrove swamps, shallow coastal bays, and lagoons. Within such habitats, anhingas are able to stalk slow-moving prey and seek refuge from danger in the water, and perch and sun itself in the treetops.

Aquatic Biomes: lakes and ponds; rivers and streams; coastal

Other Habitat Features: riparian ; estuarine

  • Owre, O. 1967. Adaptations for locomotion and feeding in the Anhinga and the Double-crested Cormorant. Ornithological Monographs, 6: 138-276.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Freshwater swamps, lakes, and sluggish streams at low elevations and, in tropical regions, primarily around brackish lagoons and in mangroves (AOU 1983). In Louisiana, most nesting areas are freshwater, some brackish; mainly cypress swamps, sometimes in freshwater marshes (Portnoy, cited by Johnsgard 1993). Favored habitats have areas of open nonturbid water (Palmer 1962). Nests near top of tree or shrub 1-6 m above water or ground, often near wading birds and cormorants. Male establishes nest site, both sexes build.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

In the U.S., northerly breeders are migratory, arrive in breeding areas March-April, depart by early October (Palmer 1962). Basically nonmigratory in south.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Anhingas prey primarily on fish (Percidae, Centrarchidae, Peociliidae, Cyprinodontidae), but their diet can also include aquatic invertebrates and insects. Although not particularly fast swimmers, they are effective aquatic hunters, relying on their quick necks and sharp bills to catch prey. They target slower-moving species of fish and stalk them underwater, finally striking out with their long neck and spearing the prey with the beak. They then bring the prey above water and manipulate it in order to swallow the fish head first.

Animal Foods: fish; insects; aquatic crustaceans

Primary Diet: carnivore (Piscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Eats mainly fishes; also other aquatic vertebrates and invertebrates (see Johnsgard 1993 for details). Dives from water surface or while flying or from perch, spears fishes on bill (Palmer 1962).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Generally alone or in pairs.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Normally quiet birds, vocalizations include clicks, rattles, croaks, and grunts. Anhingas typically call while on or near the nest, and occasionally while flying or perching. They are particularly silent and elusive when flightless due to molting.

Communication Channels: acoustic

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Range lifespan

Status: wild:
16.4 (high) years.

Average lifespan

Status: wild:
143 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 16.4 years (captivity)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Anhingas are monogamous and pairs may reuse nests from year to year. The male begins courtship by soaring and gliding, followed by marking a possible nest location with leafy twigs. Then he performs behavioral displays to attract the female. Once the pair is formed, the male gathers nesting material, while the female builds a platform nest, which is usually on a branch overhanging water or in open areas in the tops of trees. The female constructs the nest by weaving sticks together and padding it with live twigs and green leaves. Usually, the highly territorial males defend any threats to nesting territories with extensive displays and even fighting. If another male approaches the territory, the resident male spreads its wings and snaps its beak. If no retreat occurs, fighting will commence by pecking at each other's heads and necks. Females are less aggressive, but will defend the nest if necessary.

Mating System: monogamous

Anhingas are believed to reach sexual maturity around two years of age. Breeding occurs seasonally in North America. In sub-tropical or tropical latitudes, breeding can occur throughout the year, or be triggered by wet or dry seasons. The female lays one egg every one to three days, until she has a clutch anywhere from two to six eggs. Average clutch size is four eggs. The oval-shaped eggs are bluish-white or pale green, sometimes occurring with brown speckles.

Breeding season: Anhingas may breed seasonally or throughout the year, depending on latitude.

Average eggs per season: 4.

Range time to hatching: 25 to 30 days.

Average fledging age: 6 weeks.

Key Reproductive Features: iteroparous ; seasonal breeding ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

The parents share in incubating the eggs for 25 to 30 days. In Mexico, anhingas were documented as performing particular displays when males and females switch incubating duties at the nest. These displays included two parents vocalizing to one another, and the incubating bird neck-stretching toward the mate. After the birds intertwined necks and the returning bird passed nesting material to the incubating bird, the two switched places. Upon hatching, anhinga chicks are naked and helpless. They eventually grow a white down on their belly side and a dark down on their back side. At first the parents feed the chicks by dripping fluid and regurgitated material from partially digested fish down their throats. As the chicks grow older, they shove their heads down the parents' beaks to get this food material. The chicks are in the nest approximately three weeks, but if threatened, are able to drop into the water and swim away, later climbing out of the water and back into the nest. At the end of three weeks, they are able to climb out of the nest to a branch, and fledge at approximately six weeks. They stay with their parents for several more weeks before becoming independent.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Protecting: Male, Female)

  • Burger, J., L. Miller, D. Hahn. 1978. Behavior and Sex Roles of Nesting Anhingas at San Blas, Mexico. Wilson Bull., 90(3): 359-375.
  • del Hoyo, J., A. Elliot, J. Sargatal. 1992. Handbook of the Birds of the World. Vol. 1, Ostrich to Ducks.. Barcelona: Lynx Edicions.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eggs are laid from February through June (peak from mid-March through April) in Florida, April-early June in Texas-Louisiana (limited data), July on the west coast of Mexico (see Johnsgard 1993). Clutch size usually is 2-5 (mean between 3 and 4 in the U.S.). Incubation, by both sexes in turn, lasts about 25-28 days. Young are tended by both parents, can fly by 6 weeks, independent at 8 weeks. Sexually mature probably in 2 years. Nests singly or in small colonies, up to 100s of pairs, separated into clusters of 8-12 pairs.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Anhinga anhinga

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATACCTAATCTTTGGAGCTTGAGCTGGCATAATTGGAACAGCTCTAAGCTTACTAATCCGTGCAGAACTTGGTCAGCCAGGGACTCTCCTAGGAGATGACCAAATCTACAATGTAATCGTTACCGCACATGCATTCGTAATAATCTTCTTTATAGTAATACCAATTATAATTGGAGGGTTCGGAAACTGACTTGTTCCACTTATAATTGGAGCACCCGATATAGCATTTCCACGCATGAACAATATAAGCTTCTGACTTCTACCACCATCCCTGCTACTCCTACTAGCCTCATCCACAGTAGAAGCAGGGGCAGGTACAGGATGAACTGTATACCCCCCATTAGCAGGAAATCTAGCCCATGCTGGAGCTTCAGTAGACCTGGCTATCTTCTCCCTTCACCTAGCAGGAGTTTCCTCAATTTTAGGAGCAATCAACTTCATCACAACCGCTATCAACATAAAACCCCCAGCTCTTTCACAATATCAAACCCCATTATTTGTCTGATCCGTCCTAATCACCGCCATTCTACTCTTACTATCACTTCCAGTACTCGCTGCTGGAATCACTATGCTCTTAACCGACCGAAACTTAAACACAACATTCTTTGACCCAGCAGGAGGGGGTGACCCCATCCTTTATCAACATTTATTTTGATTCTTTGGCCACCCAGAAGTATACATTCTTATCCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Anhinga anhinga

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5