Articles on this page are available in 1 other language: Spanish (8) (learn more)

Overview

Distribution

Violet sabrewing hummingbirds (Campylopterus hemileucurus) have a broad geographic range extending across the neotropics. Violet sabrewings occur throughout portions of northern Mexico, El Salvador and Guatemala, to Costa Rica and Honduras. Their distribution extends as far south as northern South America.

Biogeographic Regions: neotropical (Native )

  • 2010. "IUCN Red List of Threatened Species" (On-line). Campylopterus hemileucurus. Accessed April 04, 2011 at www.iucnredlist.org.
  • Sibley, C., B. Monroe Jr. 1990. Distribution and Taxonomy of Birds of the World. New Haven: Yale University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Campylopterus hemileucurus is one of the larger hummingbird species in the Family Trochilidae, usually growing to an average length of 15 cm. It is brilliantly colored, with a variety of sharp violets, greens, blacks, blues, and whites. The dark violet and bright blue feathers, mixed with dark forest-green feathers, provide excellent camouflage in forested areas. Its name, sabrewing, refers to the striking flat and thick shafts on its outer feathers. The bill is long and curved, well-adapted for extracting nectar from flowering plants. Flowers with radial symmetry are preferred, because they can easily hover beside the plant while extracting nectar.

Male and female Campylopterus hemileucurus have different coloration. The male's body is generally dark violet and blue on the ventral side, with dark green or black on the dorsal side. Females tend to be more greenish on the ventral side and black on the dorsal side. Both are easily recognized by their distinctive violet throats. Males and females share the same tail pattern with black and white coloration. Juvenile violet sabrewings are distinguished by their lack of violet coloration and flat feathers.

Range mass: 9 to 12 g.

Average length: 15.24 cm.

Average wingspan: 82.6 mm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes colored or patterned differently; male more colorful

  • Marin, M. 2001. Postnatal development of the violet sabrewing in Costa Rica. The Wilson Bulletin, 113/1: 110-114.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Campylopterus hemileucurus is found in tropical habitats, particularly coastal slopes, inland forests, and tropical grasslands. They occur at elevations ranging from 3,300 to 8,000 meters. Campylopterus hemileucurus does not migrate, because food (nectar from flowers and small insects) is abundant in their habitats year-round. Thus, this region provides an excellent place for breeding and there is no need for migration.

Range elevation: 3,300 to 8,000 m.

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: savanna or grassland ; forest

Aquatic Biomes: coastal

  • Land, H. 1963. A collection of birds from the Caribbean lowlands of Guatemala. The Condor, 65/1: 49-65.
  • Skutch, A., S. Adams, C. Henderson. 2010. Birds of Costa Rica: A Field Guide. Austin Texas: University of Texas Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Hummingbirds are very small birds with high metabolisms. They must feed almost constantly since most of their energy is spent flying. Campylopterus hemileucurus is primarily nectivorous but also insectivorous. Most of their diet comes from floral nectar, with the rest from arthropods (Phylum Arthropoda), including flies (Order Diptera), spiders (Order Araneae), ants (Order Hymenoptera), beetles (Order Coleoptera), and other small organisms. They occasionally feed on non-insect arthropods. Their only limitation in feeding is prey size, although they are capable of swallowing surprisingly large organisms.

Food choice of all hummingbirds is chiefly determined by season and habitat. As a non-migratory hummingbird, C. hemileucurus depends on local food resources. They obtain nectar from brightly colored flowers, particularly those in the Neotropical genus Marcgravia during their flowering season. They are most attracted to red and yellow flowers that are shaped like their beaks (long, tubular, and radially symmetric). When hummingbirds open their beaks, they lap up the nectar with their tongues, which have grooves on the sides that collect the liquid. Violet sabrewings can consume considerable amounts of nectar, almost equal to twice their weight, on a daily basis.

Convenience also plays a major role in the feeding patterns of this bird. They visit flowers from which they can most easily obtain insects and nectar. During other parts of the year, when floral nectar is limited, arthropods are their main food source. During this period, C. hemileucurus often hovers over forest streams and darts at large swarms of gnats. This hovering technique during feeding is common in all hummingbirds.

Animal Foods: insects; terrestrial non-insect arthropods

Plant Foods: nectar

Primary Diet: herbivore (Nectarivore )

  • Remsen, J., F. Stiles, P. Scott. 1986. Frequency of arthropods in stomachs of tropical hummingbirds. The Auk, 103/2: 436-441.
  • Wagner, H. 1946. Food and feeding habits of Mexican hummingbirds. The Wilson Bulletin, 58/2: 69-93.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Campylopterus hemileucurus, like many other species of hummingbirds, are pollinators. They pollinate various tropical plants while feeding on nectar. Oftentimes they pollinate plants used to shade coffee plantations. Without these birds and their relatives, many tropical plants would be unable to reproduce and local coffee production would be reduced. A small group of invertebrates known as hummingbird mites also feed on nectar. They use hummingbirds to transport them from plant to plant to feed on nectar.

Ecosystem Impact: pollinates

Commensal/Parasitic Species:

  • Hummingbird mites

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Adult violet sabrewings have few predators. This has been attributed to mostly to their large body size. However, juvenile hummingbirds are threatened by mice and cats. Nest predators are the greatest threat to offspring; these include snakes, jays, toucans, hawks, and a few bats.

Male violet sabrewings are easy to recognize with their bright purple coloring and large size. Females, in contrast, have a cryptic coloration, an adaptation that camouflages them from predators. Female hummingbirds also fly in a zigzag when returning to their nests in order to evade predators.

Known Predators:

  • snakes (Suborder Serpentes)
  • jays (Family Corvidae)
  • bats (Suborder Microchiroptera)
  • toucans (Family Ramphastidae)
  • hawks (Family Accipitridae)

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Campylopterus hemileucurus communicates through calls and songs. Both males and females produce specific calls. These calls are commonly short sharp twitters made while visiting flowers to feed. Males generate high-pitched songs that are used both to attract mates as well as to defend their territories. Like other hummingbirds (Family Trochilidae), the wings of C. hemileucurus create a humming noise during flight.

Campylopterus hemileucurus has excellent visual perception and can see things at far distances. They have color vision and are drawn to brightly colored flowers for their nectar. They also have ultra-violet light perception that aids in their foraging for nectar, since many flowers have such color patterns. They do not have a well-developed sense of smell and generally visit flowers with little to no scent. In addition, their hearing is extremely finely tuned. They can hear high-pitched sounds and detect tiny differences in sound quality.

Like most birds, Campylopterus hemileucurus perceives its environment through visual, tactile, auditory and chemical stimuli.

Communication Channels: visual ; acoustic

Perception Channels: visual ; ultraviolet; tactile ; acoustic ; chemical

  • Howell, S. 2002. Hummingbirds of North America. San Diego: AP Natural World.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Little or no data has been collected for lifespan of C. hemileucurus or other species in the genus Campylopterus. The average lifespan of hummingbirds in the Family Trochilidae is 3 to 5 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Campylopterus hemileucurus behaves much like other species of hummingbirds during the mating season. Males form groups of six to ten and begin to sing loudly from their leks. Females, upon hearing the mating call, begin to build nests using mosses and other plant material. Grasses and small twigs found throughout the surrounding habitat are used for nest building just before mating. This usually occurs during the rainy season (May through August). Like all hummingbirds and typically all lekking species, C. hemileucurus is polygynous. Pairs remain together only long enough for fertilization. The males then abandon the nest, leaving the females to incubate the eggs and care for the offspring.

Mating System: polygynous

The breeding season for C. hemileucurus occurs during the rainy season from May through August. It is thought that the hummingbirds choose this season for its abundance of food, both for themselves and for the offspring. A clutch size of two eggs per nest is typical. Females incubate these eggs for 20 days. After a few hours of hatching, females begin feeding spiders and fluids to the offspring. About 11 to 12 days later, young nestlings reach their full body mass, with males tending to be larger than females. Nestlings fledge 22 to 24 days after hatching. In many hummingbird species, the female feeds her fledglings for 18 to 25 days after they have left the nest, but exact duration for C. hemileucurus is unknown. Reproductive age is also currently unknown.

Campylopterus hemileucurus usually breeds twice per season. Females typically build a second nest close to or on top of their first.

Breeding interval: Campylopterus hemileucurus breeds two times per season

Breeding season: The breeding season occurs from May through August

Average eggs per season: 2.

Average time to hatching: 21 days.

Range fledging age: 22 to 24 days.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Female violet sabrewings are the main providers of care for offspring. After the incubation period, females care for the young nestlings even after they have fledged. Within hours of being born, the mothers begin to feed the newborn nestlings a diet that consists of fluids and spiders. During the coming weeks the mother will continue to care for the young protecting them from predators such as other birds, mice, and cats until they have all reached independence and are able to survive on their own.

Parental Investment: altricial ; female parental care ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female)

  • Marin, M. 2001. Postnatal development of the violet sabrewing in Costa Rica. The Wilson Bulletin, 113/1: 110-114.
  • Schuchmann, K. 1999. Family Trochilidae. J del Hoyo, A Elliott, S Jordi, eds. Handbook of the Birds of the World, Vol. 5. Barcelona: Lynx Edicions.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Campylopterus hemileucurus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACTATACCTAATTTTCGGAGCATGAGCTGGAATAGTTGGAACCGCCCTCAGCCTACTAATCCGAGCAGAACTAGGCCAACCAGGCACCCTACTAGGAGACGACCAAATCTACAATGTAATCGTCACCGCCCACGCTTTCGTAATAATCTTCTTCATAGTTATACCAATCATGATTGGAGGGTTTGGAAACTGACTAATTCCCCTGATAATCGGAGCGCCTGACATAGCATTTCCACGTATAAATAACATAAGCTTCTGACTCTTACCACCATCATTTCTCCTCCTCCTCGCCTCCTCTACTGTAGAAGCAGGCGCGGGCACAGGGTGGACTGTATATCCGCCCCTAGCCGGCAACCTAGCTCACGCAGGAGCATCAGTAGACTTGGCTATCTTCTCCCTACACCTATCCGGCATCTCATCAATCCTAGGAGCAATTAACTTCATCACCACCGCAATCAATATAAAACCACCCGCCCTATCACAATACCAAACCCCCCTATTCGTCTGATCCGTCCTCATTACTGCCGTCCTACTCCTCCTCTCACTCCCAGTGCTCGCTGCAGGAATCACCATACTACTTACAGACCGAAACCTAAACACCACCTTCTTTGACCCTGCCGGAGGAGGAGACCCCATCCTCTACCAACACTTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Campylopterus hemileucurus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has a very large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend is not known, but the population is not believed to be decreasing sufficiently rapidly to approach the thresholds under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5