Articles on this page are available in 1 other language: Chinese (Simplified) (6) (learn more)

Overview

Distribution

North America; Oceania; accidental from Eurasia; many records from Maritimes and East Coast as well as inland
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Transient

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) BREEDING: Eurasia. NON-BREEDING: south to Old World tropics, east to Phillipines, occasionally west to Hawaii. Accidental in most of North America (some of these records may be based on escapes) (AOU 1983, Pratt et al. 1987). Regular migrant in Alaska (NGS 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Palearctic; winters to s Africa and Australasian region.
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Length: 39 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Length: 37-41 cm. Plumage: Breeding male vermiculated grey flanks, dark back, mottled brown breast; Head, neck and breast dark chestnut brown with paler mottling on breast and cheeks; bold white eyebrow stripe from above eye to nape; wing blue-grey, primaries darker, speculum green with white trailing edge above. Female and eclipse male brown with wide pale edges to feathers giving mottled appearance; distinctive white eyebrow and white loral patch; speculum green; belly white in all plumages. Immature like female but with spotted belly. Bare parts: iris dark or umber brown, grey in immature; bill black or grey; feet and legs dull olive grey. Habitat: rare on coastal waters of Red Sea, prefers inland water bodies.<388><391><393>
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Behaviour This species is highly migratory, breeding widely across Western Eurasia and wintering within the northern tropics (Scott and Rose 1996). It migrates on a broad front, the autumn migration beginning in late July and peaking in August or early September (in Europe and Egypt), with birds beginning to arrive in East and West Africa in early September, peaking in October (Scott and Rose 1996). Once the species reaches Africa it migrates in relation to seasonal flooding, the central point of its occurrence shifting gradually along the course of rivers as the winter progresses (Alerstam 1990). The spring migration begins in February, with birds beginning to arrive on breeding grounds from mid-March to early-May (Scott and Rose 1996). It is a highly sociable and gregarious species (Cramp and Simmons 1977, Madge and Burn 1988), and whilst breeding can be found in single pairs or small groups, but regularly forms large congregations of several hundred on passage, and flocks of up to several thousand are common in African and Asiatic winter quarters (Cramp and Simmons 1977, Madge and Burn 1988). Adults undergo a post-breeding moult period that leaves them flightless for 3-4 weeks, with males moulting between mid-July and mid-August, and females between mid-August and September (Cramp and Simmons 1977, Kear 2005b). The Volga Delta, in particular, is a major moulting area for this species. Birds of this species are both diurnal and nocturnal feeders, and when migrating often travel by night and rest on open water during the day (Johnsgard 1978). Habitat Breeding In the breeding season this species frequents small, shallow ponds and lakes with abundant floating, emergent and fringing vegetation (Johnsgard 1978, de Hoyo. 1992) (that is not too tall or dense, such as bulrush - Typha spp.) (Cramp and Simmons 1977, Green 1998), in grass dominated environments, like swampy meadows, flooded fields, shallow freshwater marshes (Johnsgard 1978, de Hoyo. 1992, Schricke 2001). Non-breeding During this season the species shows a preference for large freshwater or occasionally brackish lakes, again with abundant floating, emergent and fringing vegetation (Kear 2005b), also shallow flood plains, shallow dams, pans and sewage ponds (in South Africa) (Hockey et al. 2005). The species also frequents coastal saltmarshes and lagoons on passage (de Hoyo. 1992) and may spend the day resting on marine inshore waters when migrating (Madge and Burn 1988). Diet Breeding When breeding this species is omnivorous (Johnsgard 1978). In spring and summer its diet is dominated by animal matter: chiefly molluscs, aquatic insects and their larvae (waterbugs, caddisfly, waterbeetles, midges), crustaceans (ostracods and phyllopods especially), worms, leeches, young and spawn of frogs, and small fish (Johnsgard 1978, Hockey et al. 2005). Seeds, roots, tubers, stems, leaves and buds of plants such as Hornwort Ceratophyllum, Naiad Najas, sedge, grass and other aquatic plants are also important at this time (Cramp and Simmons 1977, Johnsgard 1978, de Hoyo. 1992). Non-breeding During this season the birds are mainly vegetarian, with a diet dominated by the seeds of pondweeds, smartweeds Polygonum, sedges, dock Rumex, wild rice and grass (Kear 2005b), (with the seeds of Echinochloa colona, Nymphea micranthia and Nymphea lotus being the most preferred food items) (Treca 1981). Breeding site Meadows are the favoured nesting areas of this species, with nests rarely located more than 150 m from water (usually within 20 m) (Cramp and Simmons 1977). The nest itself is a depression in the ground, typically situated under rushes or tall grasses (such as manna grass, Glyceria), but not generally under shrubs (Johnsgard 1978, de Hoyo. 1992).

Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Shallow inland lakes, ponds, and streams bordered with dense emergent vegetation, reed beds, or marshes; winters primarily on fresh water but also in brackish and marine situations (AOU 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 14.5 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Anas querquedula

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TCTATACCTTATCTTCGGGGCATGAGCCGGAATAATTGGCACAGCACTAAGCCTACTAATCCGCGCAGAACTTGGTCAACCAGGAACCCTCCTGGGCGATGACCAAATTTACAACGTGATCGTCACCGCTCACGCCTTTGTAATAATTTTCTTCATAGTAATGCCCATCATAATTGGGGGATTTGGCAACTGATTGGTCCCCCTGATAATCGGTGCCCCCGACATAGCATTCCCACGAATAAATAACATAAGCTTCTGACTCCTTCCACCATCATTCCTTCTACTACTCGCCTCATCTACCGTAGAAGCTGGCGCTGGCACAGGTTGAACCGTGTACCCGCCCCTAGCAGGCAACCTAGCCCATGCCGGGGCATCAGTAGACCTGGCCATTTTCTCACTCCACCTAGCCGGTGTTTCCTCCATCCTTGGAGCCATTAACTTCATTACCACAGCCATCAACATAAAACCCCCTGCACTCTCACAGTACCAAACCCCACTTTTCGTCTGATCAGTCCTAATTACCGCCATCCTGCTCCTCCTGTCACTTCCTGTCCTTGCCGCCGGCATTACAATGCTGCTAACCGACCGGAACCTAAACACTACATTCTTTGACCCTGCCGGAGGAGGAGACCCGATCCTGTACCAACACCTATTTTGATTCTTCGGCCACCCAGAAGTTTATATCTTAATTCTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Anas querquedula

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2015

Assessor/s
BirdLife International

Reviewer/s
Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (extent of occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2012
    Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5