Articles on this page are available in 1 other language: Spanish (20) (learn more)

Overview

Brief Summary

Aythya affinis

When floating far out on the water, it can be difficult to separate the Lesser Scaup (16 1/2 inches) from its relative, the Greater Scaup (Aythya marila) (18 inches). Males of both species are medium-sized ducks with dark heads and chests, light backs and flanks, and dark tails. A closer look reveals that the Lesser Scaup has a peaked, purple-tinged head and light gray flanks (as opposed to the Greater Scaup, which has a flat-topped, green-tinged head and white flanks). The females of both species (both dark brown) are also difficult to separate, although the female Lesser Scaup tends to be slightly darker brown than the female of the other species. Both species also have blue bills, earning them the nickname “bluebill” with duck hunters. The Lesser Scaup breeds across much of western Canada and Alaska, with smaller breeding populations in the northern Great Plains, in northern portions of the Rocky Mountains, and in the Great Lakes region. Most Lesser Scaups migrate south in winter, when they may be found along the Pacific and Atlantic coasts of the U.S., in the Ohio River Valley, in the interior south and southwest, and south to Mexico, Central America, and the Caribbean. Lesser Scaup are also known to winter in Hawaii. Lesser Scaups breed on fresh or slightly brackish wetlands with marsh grasses. In winter, they may be found in large numbers on large lakes, bays, and reservoirs. Although they may be found in saltwater in winter, Lesser Scaup are somewhat less likely to be seen on the open ocean than the Greater Scaup. This species’ diet primarily consists of invertebrates, such as crustaceans, mollusks, and insects when available. One of several species of “diving ducks” in North America, Lesser Scaups may be observed submerging themselves to feed on invertebrates in the water or on the bottom. In winter, they may also be observed in flocks of many hundreds or thousands of birds on large bodies of water. This species is primarily active during the day.

Threat Status: Least Concern

  • Austin, Jane E., Christine M. Custer and Alan D. Afton. 1998. Lesser Scaup (Aythya affinis), The Birds of North America Online (A. Poole, Ed.). Ithaca: Cornell Lab of Ornithology; Retrieved from the Birds of North America Online: http://bna.birds.cornell.edu/bna/species/338
  • Aythya affinis. Xeno-canto. Xeno-canto Foundation, n.d. Web. 20 July 2012. .
  • Lesser Scaup (Aythya affinis). The Internet Bird Collection. Lynx Edicions, n.d. Web. 20 July 2012. .
  • Peterson, Roger Tory. Birds of Eastern and Central North America. Boston: Houghton Mifflin, 1980. Print.
  • Sibley, Daid Allen. The Sibley Guide to Birds, 2nd Edition. New York: Alfred A, Knopf, 2014. Print.
  • eBird Range Map - Lesser Scaup. eBird. Cornell Lab of Ornithology, N.d. Web. 20 July 2012. .
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Institution

Supplier: DC Birds

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

North America; Scotian shelf to the Gulf of Mexico
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lesser scaup are an American species of diving duck. They breed in interior boreal forests and parklands of Alaska and Canada and into the United States in North and South Dakota, Montana, Wyoming, northeastern Washington, and the Klamath region of southern Oregon and northeastern California. In winter they are found in appropriate habitat in the Pacific coastal states, the southern states, including Colorado, the southeast, Florida, and along the Atlantic coast to Massachusetts. They are also found in the southern Great Lakes region and Ohio and Mississippi river drainages. Lesser scaup also winter throughout Mexico and Central America, the Antilles, and the Hawaiian Islands. Occasional birds are seen in winter in the western Palearctic, Greenland, British Isles, Canary Islands, and the Netherlands.

Biogeographic Regions: nearctic (Native ); neotropical (Native )

  • Austin, J., C. Custer, A. Afton. 1998. Lesser Scaup (Aythya affinis). The Birds of North America Online, 338: 1-17.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) BREEDING: central Alaska and Mackenzie Delta to northern Manitoba and northern Ontario south to southern British Columbia, northern Idaho, northern Wyoming, northern North Dakota, and Minnesota, casually or irregularly east to central Quebec and south to Washington, central California, northern Utah, central Colorado, central Nebraska, northwestern Iowa, central Illinois, and northern Ohio (AOU 1998). NON-BREEDING: southern Alaska, and from southern British Columbia, southern Idaho, Utah, northeastern Colorado, Kansas, Iowa, southern Great Lakes region, and New England south throughout the southern U.S., Middle America, and West Indies to northern Colombia, northern Venezuela (very small number at southern limit of this range); small numbers in Hawaii. Primary wintering areas in the U.S. include the Atlantic and Gulf coastal plains, Mississippi Valley north to the Ohio River, and the Pacific states, plus southern British Columbia; the highest densities occur in southern Florida and along the Mississippi River (Root 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Lesser scaup are an American species of Aythya. They breed in cold, northern lakes in interior Alaska and Canada and into parts of the northern United States. In winter they are found on bodies of water along the Pacific and Atlantic coasts of the United States, the southern United States, Florida, and along the Atlantic coast to Massachusetts. They are also found in the southern Great Lakes region and Ohio and Mississippi river drainages. Lesser scaup also winter throughout Mexico and Central America, the Antilles, and the Hawaiian Islands.

Biogeographic Regions: nearctic (Native ); neotropical (Native )

  • Austin, J., C. Custer, A. Afton. 1998. Lesser Scaup (Aythya affinis). The Birds of North America Online, 338: 1-17.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Alaska to s US; winters n South America and Hawaiian Islands.
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Lesser scaup are medium-sized diving ducks. Males are slightly larger than females: from 40.4 to 45.1 cm in males and 39.1 to 43.4 cm in females, and from 700 to 1200 g in males and 600 to 1100 g in females. Males and females have different plumage patterns throughout most of the year. Males in breeding plumage (August to the following June) have a blue bill, purplish-black head, breast, neck, tail, and vent. The sides and belly are white and the back is white with grey flecking. Females are chocolate brown, with lighter sides, a rufous head, and a white patch at the base of their dark grey bill. In all birds the secondary feathers are white at the end, resulting in a white wing stripe on the trailing edge of the upper wing surface. Iris color varies with sex and age. Irises are grayish in hatchlings, become yellow-green in juvenile males, and then deep yellow in adult males. Iris color in females stays a brownish color.

Lesser scaup are difficult to distinguish from their close relatives, greater scaup (Aythya marila), especially at a distance. There is no documented geographic variation and no subspecies described.

Range mass: 600 to 1200 g.

Range length: 39.1 to 45.1 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger; sexes colored or patterned differently; male more colorful

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Lesser scaup are medium-sized Aythya. Males are slightly larger than females. Males and females have different feather colors throughout most of the year. Males in breeding plumage (August to the following June) have a blue bill and purplish-black head, breast, neck, tail, and vent. The sides and belly are white and the back is white with grey spots. Females are chocolate brown, with lighter sides, a reddish head, and a white patch at the base of their dark grey bill. In all lesser scaup there is a white wing stripe on the trailing edge of the upper wing surface.

Range mass: 600 to 1200 g.

Range length: 39.1 to 45.1 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger; sexes colored or patterned differently; male more colorful

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 42 cm

Weight: 850 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 1 specimen in 1 taxon.

Environmental ranges
  Depth range (m): 0 - 0
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lesser scaup are reliant on wetland habitats for foraging and breeding. They are found throughout the year on semi-permanent or seasonal wetlands with emergent vegetation (such as cattails, Typhus, or bulrushes, Scirpus) or submergent vegetation (pondweed, Potamogeton, water milfoil, Myriophyllum spicatum, hornwort, Ceratophyllum demersum, or muskgrass, Chara). They are most abundant in ponds with high amphipod abundance and intact wetland margins. They are found in freshwater or slightly brackish wetland areas, including ponds, lakes, river impoundments, and coastal bays. Preferred wetlands are fairly shallow. Lesser scaup nest in wetland meadow or grassland areas near ponds.

Habitat Regions: temperate ; freshwater

Terrestrial Biomes: savanna or grassland

Aquatic Biomes: lakes and ponds; rivers and streams; temporary pools; coastal ; brackish water

Wetlands: marsh ; bog

Other Habitat Features: estuarine

  • Lindeman, D., R. Clark. 1999. Amphipods, land-use impacts, and lesser scaup (Aythya Affinis) distribution in Saskatchewan wetlands. Wetlands, 19: 627-638.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: BREEDING: Marshes, ponds, and small lakes (AOU 1998). Usually nests near small ponds and lakes, sedge meadows, creeks; in cover 1-2 ft high, within 46 m of water. Often nest on islands among colonies of gulls or terns. NON-BREEDING: During migration and when not breeding, found along coast in sheltered bays, estuaries, and marshes or inland on lakes, ponds, and rivers; on salt water especially if lakes and ponds frozen. In southern winter range, prefers freshwater ponds, lakes, and sloughs with reasonably clear water 1 m or more deep (Stiles and Skutch 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lesser scaup breed and look for food in wetland habitats. They are found throughout the year on wetlands, lakes, ponds, and along coastlines with vegetation in and above the water, like Typhus or Scirpus and Potamogeton or Myriophyllum spicatum. Lesser scaup are most common on ponds with lots of Amphipoda for them to eat. They build their nests on the land near ponds.

Habitat Regions: temperate ; freshwater

Terrestrial Biomes: savanna or grassland

Aquatic Biomes: lakes and ponds; rivers and streams; temporary pools; coastal ; brackish water

Wetlands: marsh ; bog

Other Habitat Features: estuarine

  • Lindeman, D., R. Clark. 1999. Amphipods, land-use impacts, and lesser scaup (Aythya Affinis) distribution in Saskatchewan wetlands. Wetlands, 19: 627-638.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 1 specimen in 1 taxon.

Environmental ranges
  Depth range (m): 0 - 0
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Migrates northward usually in March-April, arriving in far north late May-early June. Departs far north by the end of September, migrates southward through U.S. mainly October-November. Scaup that breed along Beaufort Sea coast winter throughout broad range of central and southern latitudes in North America, from coast to coast.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Lesser scaup adults and young eat insects, crustaceans, and mollusks. They sometimes also take the seeds of aquatic plants, such as yellow pond lily (Nuphar). They forage in shallow, open water by diving. They dive at an angle and surface a few meters from where they dived. They mostly eat prey underwater, but will bring larger prey to the surface to handle it there. Diet varies with the seasonal availability of food and regionally. In breeding lakes amphipods are especially important in the diet. Midges (Chironomidae) and leeches (Hirudinea) are also important in northern lakes. Mollusks and plant seeds become more important at other times of the year and fish and their eggs are taken opportunistically. Seeds become more important in the diet in fall.

Animal Foods: fish; eggs; insects; mollusks; terrestrial worms; aquatic crustaceans

Plant Foods: seeds, grains, and nuts

Primary Diet: carnivore (Insectivore , Eats non-insect arthropods, Molluscivore , Vermivore)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Feeds on seeds of pondweeds, widgeon grass, wild rice, sedges, bulrushes; also crustaceans, mollusks, and aquatic insects. Diet varies with location. Most feeding occurs in fresh water of various depths, often 3-8 m. In midwinter in Louisiana and in spring and fall in northwestern Minnesota, important foods were crustaceans, insects, and mollusks; in fall, immatures fed heavily on amphipods and did not consume fishes or fingernail clams, which were important in adult diets; by dry weight, animal foods comprised over 90% of the diet in fall and spring, 61% in midwinter (Afton et al. 1991). During fall migration in Ontario, fed in large numbers on zebra mussels (DREISSENA) (Wormington and Leach 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Lesser scaup adults and young eat Insecta, Crustacea, and Mollusca. Amphipoda, Chironomidae, and Hirudinea are especially important in the diet. They sometimes also take the seeds of aquatic plants. They forage in shallow, open water by diving. They mostly eat prey underwater, but will bring larger prey to the surface.

Animal Foods: fish; eggs; insects; mollusks; terrestrial worms; aquatic crustaceans

Plant Foods: seeds, grains, and nuts

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Lesser scaup are important predators of aquatic invertebrates in northern boreal lakes. Eggs and hatchlings are taken by a wide range of terrestrial, avian, and aquatic predators. They are susceptible to a range of diseases and parasites. Recorded diseases include avian influenza A, avian cholera (Pasteurella multocida), avian botulism, and aspergillosis (Aspergillus fumigatus). Lesser scaup host a number of scaup specific helminth parasites, including, including gizzard worms (Streptocara crassicauda). Other parasites include renal coccidia (Eimeria species), blood parasites (Leucocytozoon simondi and Haemoproteus nettionis), and g.Sarcocystis> species. Leeches (Theromyzon rude) are often found on the nasal membranes of lesser scaup.

Lesser scaup nests are parasitized by other lesser scaup as well as by other ducks, including redheads, gadwall, white-winged scoters, ruddy ducks, canvasbacks, and red-breasted mergansers. Lesser scaup also parasitize the nests of other ducks, including gadwall, orthern shovelers, redheads, white-winged scoters, and canvasbacks.

Commensal/Parasitic Species:

  • gizzard worms (Streptocara crassicauda)
  • renal coccidia (Eimeria)
  • blood parasites (Leucocytozoon simondi)
  • blood parasites (Haemoproteus nettionis)
  • (Sarcocystis)
  • leeches (Theromyzon rude)
  • redheads (Aythya americana)
  • gadwall (Anas strepera)
  • canvasbacks (Aythya valisineria)
  • white-winged scoters (Melanitta fusca)
  • ruddy ducks (Oxyura jamaicensis)
  • red-breasted mergansers (Mergus serrator)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ducklings that are attacked by predators try to stay together and females will try to protect their young, but often their defenses aren't sufficient. Females try to keep their young near the cover of vegetation and the cryptic coloration of ducklings may help to protect them. Adults may feign death when taken by large predators. Most predation is on eggs and hatchlings. Eggs are taken by American mink, raccoons, red foxes, American crows, ring-billed gulls, California gulls, common ravens, and American badgers. Ducklings are taken by many of the same predators, as well as black-billed magpies, great horned owls, black-crowned night herons, Swainson's hawks, American coots, and Arctic loons. Adults are taken by the terrestrial predators mentioned, along with striped skunks and coyotes, when on the nest. Adults are also taken by snapping turtles, red-tailed hawks, peregrine falcons, snowy owls and bald eagles.

Ducklings that are attacked by predators try to stay together and females will try to protect their young. Females try to keep their young near the cover of plants and the dull brown feathers of ducklings may help to protect them. Adults may pretend to be dead when attacked by large predators. Most predation is on eggs and hatchlings. Eggs are taken by American mink, raccoons, red foxes, American crows, ring-billed gulls, California gulls, common ravens, and American badgers. Ducklings are taken by many of the same predators, as well as black-billed magpies, great horned owls, black-crowned night herons, Swainson's hawks, American coots, and Arctic loons. Adults are taken by the other mammal predators mentioned and striped skunks and coyotes when they are on the nest. Adults are also taken by snapping turtles, red-tailed hawks, peregrine falcons, snowy owls and bald eagles.

Known Predators:

  • American mink (Neovison vison)
  • raccoons (Procyon lotor)
  • red foxes (Vulpes vulpes)
  • American crows (Corvus brachyrhynchos)
  • ring-billed gulls (Larus delawarensis)
  • California gulls (Larus californicus)
  • common ravens (Corvus corax)
  • American badgers (Taxidea taxus)
  • black-billed magpies (Pica pica)
  • great horned owls (Bubo virginianus)
  • black-crowned night herons (Nycticorax nycticorax)
  • Swainson's hawks (Buteo swainsoni)
  • American coots (Fulica americana)
  • Arctic loons (Gavia arctica)
  • striped skunks (Mephitis mephitis)
  • coyotes (Canis latrans)
  • snapping turtles (Chelydra serpentina)
  • red-tailed hawks (Buteo jamaicensis)
  • peregrine falcons (Falco peregrinus)
  • snowy owls (Nyctea scandiaca)
  • bald eagles (Haliaeetus leucocephalus)

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecosystem Roles

Lesser scaup are important predators of aquatic invertebrates in northern lakes. Eggs and hatchlings are taken by a wide range of predators. They fall ill with a range of diseases and parasites, including avian influenza, avian cholera, avian botulism, aspergillosis, and a variety of worms and blood parasites.

Lesser scaup nests are parasitized by other lesser scaup as well as by other ducks, including Aythya americana, Anas strepera, Melanitta fusca, Oxyura jamaicensis, Aythya valisineria, and Mergus serrator. Lesser scaup also parasitize the nests of other ducks, including Anas strepera, Anas clypeata, Aythya americana, Melanitta fusca, and Aythya valisineria.

Commensal/Parasitic Species:

  • gizzard worms (Streptocara_crassicauda)
  • renal coccidia (Eimeria)
  • blood parasites (Leucocytozoon_simondi)
  • blood parasites (Haemoproteus_nettionis)
  • (Sarcocystis)
  • leeches (Theromyzon_rude)
  • redheads (Aythya_americana)
  • gadwall (Anas_strepera)
  • canvasbacks (Aythya_valisineria)
  • white-winged scoters (Melanitta_fusca)
  • ruddy ducks (Oxyura_jamaicensis)
  • red-breasted mergansers (Mergus_serrator)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Ducklings that are attacked by predators try to stay together and females will try to protect their young. Females try to keep their young near the cover of plants and the dull brown feathers of ducklings may help to protect them. Adults may pretend to be dead when attacked by large predators. Most predation is on eggs and hatchlings. Eggs are taken by Neovison vison, Procyon lotor, Vulpes vulpes, Corvus brachyrhynchos, Larus delawarensis, Larus californicus, Corvus corax, and Taxidea taxus. Ducklings are taken by many of the same predators, as well as Pica pica, Bubo virginianus, Nycticorax nycticorax, Buteo swainsoni, Fulica americana, and Gavia arctica. Adults are taken by the other mammal predators mentioned and Mephitis mephitis and Canis latrans when they are on the nest. Adults are also taken by Chelydra serpentina, Buteo jamaicensis, Falco peregrinus, Nyctea scandiaca and Haliaeetus leucocephalus.

Known Predators:

  • American mink (Neovison_vison)
  • raccoons (Procyon_lotor)
  • red foxes (Vulpes_vulpes)
  • American crows (Corvus_brachyrhynchos)
  • ring-billed gulls (Larus_delawarensis)
  • California gulls (Larus_californicus)
  • common ravens (Corvus_corax)
  • American badgers (Taxidea_taxus)
  • black-billed magpies (Pica_pica)
  • great horned owls (Bubo_virginianus)
  • black-crowned night herons (Nycticorax_nycticorax)
  • Swainson's hawks (Buteo_swainsoni)
  • American coots (Fulica_americana)
  • Arctic loons (Gavia_arctica)
  • striped skunks (Mephitis_mephitis)
  • coyotes (Canis_latrans)
  • snapping turtles (Chelydra_serpentina)
  • red-tailed hawks (Buteo_jamaicensis)
  • peregrine falcons (Falco_peregrinus)
  • snowy owls (Nyctea_scandiaca)
  • bald eagles (Haliaeetus_leucocephalus)

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Aythya affinis (ducks (Lesser Scaup)) is prey of:
Mammalia

Based on studies in:
USA: Iowa, Mississippi River (River)

This list may not be complete but is based on published studies.
  • C. A. Carlson, Summer bottom fauna of the Mississippi River, above Dam 19, Keokuk, Iowa, Ecology 49(1):162-168, from p. 167 (1968).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Aythya affinis (ducks (Lesser Scaup)) preys on:
Chironomidae
Gastropoda
Amnicolidae
Bivalvia
Potamya

Based on studies in:
USA: Iowa, Mississippi River (River)

This list may not be complete but is based on published studies.
  • C. A. Carlson, Summer bottom fauna of the Mississippi River, above Dam 19, Keokuk, Iowa, Ecology 49(1):162-168, from p. 167 (1968).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

NON-BREEDING: usually in flocks on open water (Ridgely and Gwynne 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Lesser scaup use a set of visual displays, sometimes accompanied by vocalizations, during courtship. The most common display is called the "cough" because they give a short "whew" sound while they flick their wings and tail. Males also use a head-throw and kinked-neck display to attract females. Lesser scaup are fairly quiet animals. Males give a soft call during courtship and a whistle during mating displays that accompanies their visual display. Females also make a soft "arrr" sound during courtship, which signals her interest in a particular male. Females make a "purrrr" call that is directed towards predators and is also used to attract the help of their male mates when they are flying from the nest to a pond. Males then keep other males away that might harass the female.

Communication Channels: visual ; acoustic

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Communication and Perception

Lesser scaup use a set of visual displays, sometimes with calls, during courtship. The most common display is called the "cough" because they give a short "whew" sound while they flick their wings and tail. Males also use a head-throw and kinked-neck display to attract females. Females also make a soft "arrr" sound during courtship.

Communication Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Most mortality occurs within the first few weeks of hatching as a result of predation and cold stress. Ducklings that are hatched from larger eggs and later in the season have higher survival rates, so nutrient reserves influence survival. Lesser scaup seem to have a flexible reproductive strategy that allows them to take advantage of temporally variable resources to maximize reproductive success. The maximum recorded lifespan in the wild is 18 years, 4 months. Annual mortality estimates range from 32 to 71%.

Range lifespan

Status: wild:
18.33 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan/Longevity

Most lesser scaup die within the first few weeks of hatching from predation and being exposed to cold weather. The maximum lifespan in the wild is 18 years, 4 months. Between 32 and 71% of lesser scaup die each year, depending on the area.

Range lifespan

Status: wild:
18.33 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 18.3 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Lesser scaup are monogamous. Mate-switching is common during the breeding season. Pairs are formed during late spring migration and last only until the females have been incubating the eggs for some time. Forced extra-pair copulations are common.

Mating System: monogamous

Lesser scaup are one of the latest nesting ducks in North America. Most individuals arrive on breeding grounds by May and nesting and egg-laying activity peaks in June. Nesting is highly synchronous across large geographic areas. Females and males start the nest as a scrape in a grassy area, gradually adding grasses and feathers to form a bowl throughout incubation. Females lay from 6 to 14 pale, greenish eggs in a clutch. They lay 1 egg per day until the clutch is complete and begin incubating a day or two before the final egg is laid. Some females lay eggs in the nests of other females. Larger clutches are found in southern populations than in northern populations. Males abandon their female mates on the nest in mid to late June, about mid-way through incubation, which lasts 21 to 27 days. Lesser scaup ducklings that hatch from larger eggs and later in the season have higher survival rates than others. It is thought that lesser scaup breed later in the season than other North American ducks in order to take best advantage of amphipod prey abundance, which increases later in the season. Young can fly 47 to 61 days after hatching. Males and females can breed in the first year after hatching, although breeding may be delayed in unfavorable years.

Breeding interval: Lesser scaup breed once yearly, they typically lay one clutch, but may attempt a replacement clutch if the first is destroyed early in the season.

Breeding season: Breeding occurs in May and June.

Range eggs per season: 6 to 14.

Average eggs per season: 8-10.

Range time to hatching: 21 to 27 days.

Range fledging age: 47 to 61 days.

Range time to independence: 2 to 5 weeks.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Only females incubate the eggs and care for the young after hatching. Males abandon females during the incubation phase. Young are precocial at hatching and can feed themselves. Females lead their brood away from the nest within a day of hatching. Young feed from the water surface initially, but feed by diving by 2 weeks old. Females attend their brood for 2 to 5 weeks after hatching, often abandoning them before they begin to fly.

Parental Investment: precocial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Protecting: Female)

  • Austin, J., C. Custer, A. Afton. 1998. Lesser Scaup (Aythya affinis). The Birds of North America Online, 338: 1-17.
  • Dawson, R., R. Clark. 1996. Effects of variation in egg size and hatching date on survival of Lesser Scaup Aythya affinis ducklings.. Ibis, 138: 693-699.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Egg-laying begins in early May in the south to mid-June in the north. Clutch size: 6-15 (usually 9-12, largest in older females). Incubation: 22-27 days, by female (Terres 1980). Young are tended by female. Variable percentage of yearling females do not breed.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lesser scaup form male-female pairs for the breeding season when they are migrating in the spring. Before the females begin laying eggs, they sometimes switch mates.

Mating System: monogamous

Lesser scaup nest later than most other North American ducks. They arrive in the breeding area in May and build nests and lay eggs in June. Females and males start the nest as a shallow depression in a grassy area, gradually adding grasses and feathers to form a bowl throughout incubation. Females lay from 6 to 14 pale, greenish eggs in a clutch. They lay 1 egg per day until the clutch is complete and begin incubating a day or two before the final egg is laid. Some females lay eggs in the nests of other females. Males abandon their female mates about mid-way through incubation, which lasts 21 to 27 days. Young can fly 47 to 61 days after hatching. Males and females can breed in the first year after hatching.

Breeding interval: Lesser scaup breed once yearly, they typically lay one clutch, but may attempt a replacement clutch if the first is destroyed early in the season.

Breeding season: Breeding occurs in May and June.

Range eggs per season: 6 to 14.

Average eggs per season: 8-10.

Range time to hatching: 21 to 27 days.

Range fledging age: 47 to 61 days.

Range time to independence: 2 to 5 weeks.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Only females incubate the eggs and care for the young after hatching. Males abandon females when they are incubating the eggs. Young are able to walk and feed themselves when they hatch. Females lead the young away from the nest within a day of hatching. Young feed from the water surface at first, but feed by diving by 2 weeks old. Females stay with the young for 2 to 5 weeks after hatching, but then abandon them, often before they begin to fly.

Parental Investment: precocial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Protecting: Female)

  • Austin, J., C. Custer, A. Afton. 1998. Lesser Scaup (Aythya affinis). The Birds of North America Online, 338: 1-17.
  • Dawson, R., R. Clark. 1996. Effects of variation in egg size and hatching date on survival of Lesser Scaup Aythya affinis ducklings.. Ibis, 138: 693-699.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Aythya affinis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 11 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CTTATATCTTATCTTCGGGGCATGAGCCGGAATAATCGGCACAGCACTCAGCCTGCTAATCCGCGCAGAACTAGGCCAACCAGGAACCCTCCTAGGTGATGACCAGATTTACAACGTAATCGTCACCGCCCACGCCTTTGTAATAATCTTCTTCATAGTGATGCCCATCATAATCGGAGGGTTTGGCAACTGATTAGTCCCCCTAATAATCGGCGCCCCCGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGGCTCCTCCCACCCTCATTCCTCCTCCTACTCGCCTCATCCACCGTAGAAGCTGGCGCCGGCACAGGCTGAACCGTGTACCCACCTCTAGCAGGCAACCTAGCTCACGCTGGGGCCTCAGTAGACCTGGCCATTTTCTCGCTCCACTTAGCCGGTGTTTCCTCTATTCTCGGAGCCATTAACTTCATCACCACAGCCATCAACATAAAACCCCCCGCACTCTCACAATACCAGACCCCACTCTTTGTCTGATCCGTCCTAATCACCGCTATTCTGCTCCTCCTATCACTACCCGTCCTCGCCGCTGGCATCACAATACTACTAACCGACCGAAACCTAAACACCACATTCTTTGACCCCGCCGGAGGAGGCGACCCAATCCTGTACCAACACCTATTCTGATTCTTCGGCCATCCGGAAGTCTACATCTTAATCCTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Aythya affinis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 11
Specimens with Barcodes: 14
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5