Overview

Comprehensive Description

Longueur 44-47 cm, envergure 80-92 cm, poids 230-370 g.

Il habite les eaux douces stagnantes de plaine, notamment les marais agrémentés de trous d’eau, les canaux et fossés garnis d’une abondante végétation aquatique, avec des bouquets d’arbustes ou de saules où il peut se percher. Il peut pêcher à découvert dans des rizières ou des prairies inondées, mais préfère la protection d’un couvert dense.

Le Crabier se nourrit d’insectes et de leurs larves, d’amphibiens et de petits poissons. Il pêche seul ou en petits groupes lâches, de préférence au crépuscule.

L’espèce tend à être solitaire en dehors de la saison de reproduction, sauf sur les sites de dortoir où les Crabiers se regroupent volontiers. Elle est souvent grégaire au nid, s’installant au sein de héronnières mixtes et le plus souvent en petit nombre et à l’écart. Elle est monogame et le couple est formé pour une unique saison. Seuls les abords immédiats du nid sont défendus.

Le nid est une plate-forme plus ou moins fragile de branchettes ou de roseaux. La ponte unique de 4-6 œufs est déposée à partir de fin avril. L’incubation dure 23 jours et les jeunes sont volants vers l’âge de 45 jours.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Muséum national d'Histoire naturelle. Service du Patrimoine naturel

Source: Inventaire National du Patrimoine Naturel

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range

Locally in s Palearctic region, Africa and Madagascar.
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Behaviour In the Palearctic this species is migratory and dispersive (del Hoyo et al. 1992), travelling on a broad front between breeding and wintering areas (Kushlan and Hancock 2005). African breeding populations are nomadic or sedentary however and make local dispersive movements to temporary wetlands following seasonal rains (Hockey et al. 2005). The species breeds from April to July in Eurasia and North Africa (the populations south of the Sahara breeding mainly during the rainy season) (del Hoyo et al. 1992) in single- or mixed-species colonies that can be up to 2,000 pairs in size (del Hoyo et al. 1992). After breeding Palearctic populations migrate south from August to November (del Hoyo et al. 1992, Kushlan and Hancock 2005), returning to the breeding colonies between February and May (Kushlan and Hancock 2005). The species feeds solitarily (Kushlan and Hancock 2005) or in small groups of 2-5 individuals during the breeding season (Kushlan and Hancock 2005) although in winter and on migration large feeding flocks may form (Kushlan and Hancock 2005) and in Africa resident populations may feed in parties of up to 20 individuals (Brown et al. 1982). The species is mainly crepuscular (del Hoyo et al. 1992), roosting by day and night in large (Kushlan and Hancock 2005) often mixed-species (Brown et al. 1982) groups in sheltered woods and reedbeds (these roosts may draw in herons feeding up to 80 km away) (Kushlan and Hancock 2005). Habitat The species inhabits permanent or temporary wetlands (Brown et al. 1982) showing a preference for fresh waters with abundant marsh vegetation (del Hoyo et al. 1992), reedbeds, nearby bushes, trees and scrub (Kushlan and Hancock 2005). Habitats frequented include swampy plains, river valleys, deltas, lakes, ponds, canals and ditches (del Hoyo et al. 1992) although rice paddyfields (del Hoyo et al. 1992, Kushlan and Hancock 2005) are now the principle habitat throughout much of its range (Kushlan and Hancock 2005). On migration (Kushlan and Hancock 2005) the species may also occur on estuaries, inshore reefs or islets (del Hoyo et al. 1992). It generally avoids dry habitats and those with very high rainfall (Kushlan and Hancock 2005), and usually breeds in the lowlands although it has bred on montane lakes up to 2,000 m (del Hoyo et al. 1992). Diet Its diet consists predominantly of larval insects although fish and amphibians (del Hoyo et al. 1992) (e.g. frogs and tadpoles) (Kushlan and Hancock 2005) up to 10 cm long, grasshoppers, beetles, butterflies, spiders, crustaceans, molluscs and exceptionally small birds may also be taken (del Hoyo et al. 1992). Breeding site The nest is a well-constructed platform (del Hoyo et al. 1992) usually placed less than 2 m (occasionally up to 20 m) high near or over water in reedbeds (del Hoyo et al. 1992) or in dense thickets of trees or shrubs (Kushlan and Hancock 2005) (e.g. of willow Salix spp. or poplar Populus spp.) (Hafner and Didner 1997), preferring nesting sites within 5 km of feeding areas (Kushlan and Hancock 2005). The species breeds in single- or mixed-species colonies that can be up to 2,000 pairs in size (del Hoyo et al. 1992), neighbouring pairs building nests 5-10 m apart (occasionally as close as 0.5 m) (Kushlan and Hancock 2005).

Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ardeola ralloides

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

GCATGAGCTGGCATAATTGGAACTGCCCTAAGCCTACTTATCCGAGCTGAACTTGGCCAACCCGGAACACTACTAGGAGACGACCAAATCTACAATGTAATTGTCACCGCCCATGCCTTCGTAATAATTTTCTTTATAGTAATACCAATCATAATTGGAGGATTCGGAAACTGACTAGTCCCCCTCATAATTGGTGCTCCAGACATAGCATTCCCCCGTATAAACAACATAAGCTTCTGACTCCTGCCACCATCATTCATACTCCTACTAGCCTCATCCACAGTTGAAGCAGGAGCAGGTACAGGCTGAACCGTATATCCACCATTAGCTGGTAATCTAGCCCACGCCGGAGCCTCAGTCGACCTAGCCATCTTCTCCCTCCACCTGGCAGGTGTATCTTCTATCTTAGGAGCAATTAACTTCATCACAACATCCATCAACATAAAACCCCCAGCCTTATCACAATATCAAACTCCCCTGTTTGTATGATCCGTCCTAATCACTGCCGTCTTACTCCTACTCTCACTCCCAGTCCTCGCCGCAGGCATTACAATACTACTAACCGACCGAAACCTGAACACCACATTCTTTGACCCTGCCGGAGGAGGGGACCCAATCCTTTACCAACACCTCTTCTGATTCTTCGGTCACCCAGAAGTCTACATCCTAATCCTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Ardeola ralloides

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5