Articles on this page are available in 1 other language: Spanish (11) (learn more)

Overview

Brief Summary

Accipiter cooperii

The Cooper’s Hawk is often confused with its slightly smaller relative, the Sharp-shinned Hawk. Both species are blue-gray above and streaked rusty-red below with long tails, yellow legs, and small, hooked beaks. However, the Cooper’s Hawk has a rounded tail (Sharp-shinned Hawks have a squared-off tail), and is slightly larger at 14-20 inches long. Like most species of raptors, females are larger than males. Although Cooper’s Hawks may be found all year long across the majority of the United States, individual populations undertake short distance seasonal migrations. In winter, Canadian populations move south into the U.S. and southern populations move south to the Gulf coast, southern Florida, and the desert southwest. In its range, the Cooper’s Hawk is one of the most numerous and adaptable raptors. While usually found in forest habitats, this species has expanded into human-altered landscapes and now frequents towns and suburbs as well. The Cooper’s Hawk is a ‘bird hawk’ capable of hunting birds (on the ground, in trees, or in flight) from the air, and this species frequently enters yards to take small songbirds from feeders. With the aid of binoculars, Cooper’s Hawks may be seen perched in trees while scanning for prey. However, they are often more easily seen in the air while moving between perches or while actively hunting. As this species hunts by sight, it is only active during the day.

Threat Status: Least Concern

  • Accipiter cooperii. Xeno-canto. Xeno-canto Foundation, n.d. Web. 20 July 2012. .
  • Cooper's Hawk (Accipiter cooperii). The Internet Bird Collection. Lynx Edicions, n.d. Web. 20 July 2012. .
  • Curtis, Odette E., R. N. Rosenfield and J. Bielefeldt. 2006. Cooper's Hawk (Accipiter cooperii), The Birds of North America Online (A. Poole, Ed.). Ithaca: Cornell Lab of Ornithology; Retrieved from the Birds of North America Online: http://bna.birds.cornell.edu/bna/species/075
  • eBird Range Map - Cooper's Hawk. eBird. Cornell Lab of Ornithology, N.d. Web. 20 July 2012. .
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Institution

Supplier: DC Birds

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Cooper's hawks are native to the Nearctic and Neotropical regions. They can be found throughout southern Canada and the United States. They winter as far north as the northern United States and southern Ontario, and as far south as Costa Rica.

Biogeographic Regions: nearctic (Native ); neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Cooper's hawks are native to North and Central America. They can be found throughout southern Canada, the United States, and Central America. Many Cooper's hawks are migratory and populations often move north to breed. In most of the United States you can find Cooper's hawks year-round. They migrate to Central America for the winter.

Biogeographic Regions: nearctic (Native ); neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Woodlands of s Canada and US; winters to Central America.
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Cooper's hawks are medium-sized birds with long, lean-bodies. Individuals in the western part of the range tend to be smaller than those in the east. Male length ranges from 35 to 46 cm and length of female ranges from 42 to 50 cm. The average mass of males ranges from 280 g in western males to 349 g for eastern males. The average mass of females ranges from 439 g for western females to 566 g for eastern females. Cooper's hawks have a wingspan of 75 to 94 cm.

Adult Cooper's hawks have a dark blackish crown that is noticeably set off from a lighter nape. They have a blue-gray back and a tail that is crossed by several dark bands and has a distinct white band at its tip. In flight, Cooper's hawks exhibits a long barred tail and rather short and rounded wings.

The eyes of this hawk, like most predatory birds, face forward, giving it good depth perception for hunting and catching prey while flying at high speeds. The hooked bill is well adapted to tearing the flesh of prey. A swift flyer, the Cooper's hawk has a rapid wingbeat and is able to negotiate heavily vegetated woodland habitats.

Cooper's hawks can be easily confused with sharp-shinned hawks, which are smaller (25 to 35 cm) and have a less distinct dark crown and a tail that is square at the tip, unlike the rounded tip of the Cooper’s hawk’s tail. Cooper’s hawks also exhibit slower, stiffer wingbeats than sharp-shinned hawks.

Range length: 35 to 50 cm.

Average length: 39 cm.

Range wingspan: 74 to 94 cm.

Sexual Dimorphism: female larger

Other Physical Features: endothermic ; bilateral symmetry

Average mass: 526.64 g.

  • Chipper Woods Bird Observatory, 1998. "Cooper's Hawk" (On-line). Accessed July 10, 2000 at http://www.wbu.com./chipperwoods/photos/coophawk.htm.
  • Peterson, R., V. Peterson. 2002. A field guide to the birds of Eastern and Central North America, Fifth Edition. New York: Houghton Mifflin Company.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Cooper's hawks are medium-sized birds with long, lean bodies. Individuals in the western part of the range are usually smaller than those in the east. Male length ranges from 35 to 46 cm and length of females ranges from 42 to 50 cm. The average mass of males ranges from 280 g in western males to 349 g for eastern males. The average mass of females ranges from 439 g for western females to 566 g for eastern females. Cooper's hawks have a wingspan of 75 to 94 cm.

Adult Cooper's hawks have a dark blackish crown and a lighter colored neck. The back is blue-gray and the tail has several dark bands and a white band at the tip. The eyes of these hawks, like most predatory birds, face forward which gives them good depth perception for hunting and catching prey at high speeds. The hooked bill is important for tearing the flesh of their prey. In flight, Cooper's hawks display a long barred tail and rather short and rounded wings. Cooper's hawks beat their wings quickly and are able to fly very well through heavily wooded areas.

Cooper's hawks can sometimes be confused with Accipiter striatus, which are smaller (25 to 35 cm) and have a less distinct dark crown and a tail that is more square in shape.

Range mass: 280 to 566 g.

Range length: 35 to 50 cm.

Range wingspan: 75 to 94 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike; female larger

  • Chipper Woods Bird Observatory, 1998. "Cooper's Hawk" (On-line). Accessed July 10, 2000 at http://www.wbu.com./chipperwoods/photos/coophawk.htm.
  • Peterson, R., V. Peterson. 2002. A field guide to the birds of Eastern and Central North America, Fifth Edition. New York: Houghton Mifflin Company.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 51 cm

Weight: 529 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Differs from sharp-shinned hawk (ACCIPITER STRIATUS) by longer, more rounded tail that has a wider white terminal band; larger head; and (in adult) stronger contrast between the dark crown and paler nape and back. Differs from goshawk (ACCIPITER GENTILIS) in smaller size (average length 36-51 centimeters vs. 53-66 centimeters), lack of conspicuous pale eyebrow, less conspicuous white undertail coverts, broader white tip on tail, and proportionately longer tail and shorter wings (NGS 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Coopers hawks are closely associated with deciduous and mixed forests and open woodland habitats such as woodlots, riparian woodlands, semiarid woodlands of the southwest, and other areas where the woodlands occur in patches.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: savanna or grassland ; chaparral ; forest

Other Habitat Features: suburban ; riparian

  • Johnsgard, P. 1990. Hawks,Eagles, and Falcons of North America. Washington DC: Smithsonian Books.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: BREEDING: Primarily mature forest, either broadleaf or coniferous, mostly the former; also open woodland and forest edge (AOU 1983, Rosenfield and Bielefeldt 1993). Nests in both pine and hardwood groves, and riparian cottonwoods and sycamores in the West; Douglas-fir in northeastern Oregon. Usually builds new nest on horizontal limb near trunk or in crotch, 6-18 meters above ground; may modify old one or squirrel or crow nest. Campbell et al. (1990) reported one instance of a nest being reused for six consecutive years in British Columbia. Rosenfield and Bielefeldt (1992) found that nesting areas were irregularly reused by the same or different adults in subsequent years.

In Nevada, Cooper's Hawks were frequently sighted in montane forests and pinyon-juniper woodlands, but riparian habitat was recorded as well (Floyd et al. 2007). In California, this species is seldom found in areas without dense tree stands, or patchy woodland habitat. It nests in deciduous trees in crotches 3-23 m (10-80 ft), but usually 6-15 m (20-50 ft), above the ground. It also nests in conifers on horizontal branches, in the main crotch, often just below the lowest live limbs. They usually nest in second-growth conifer stands, or in deciduous riparian areas, usually near streams. They frequent landscapes where wooded areas occur in patches and groves (Beebe 1974) and often use patchy woodlands and edges with snags for perching (CDFG 2011). Cooper's Hawks tend to use older, taller, and less dense woodlots than Sharp-shinned Hawks in California (Rosenfield and Bielefeldt 1993). In southern California, Cooper's Hawk generally favors extensive riparian bottomlands (Garrett and Dunn 1981). In Oregon, nests were in stands of conifers that included older and taller trees, a deeper crown, and a more open understory than a typical single-story Sharp-shinned Hawk nest stand (Reynolds et al. 1982). See also Grindrod and Walton Cooper's Hawk account at http://www.blm.gov/ca/pdfs/cdd_pdfs/coha.pdf.

Generally is an inhabitant of deep woods, utilizing thick cover both for nesting and hunting. Openings, especially where hedgerows or windbreaks offer shelter for prey species, may also be used when foraging. Johnsgard (1990) states that Cooper's are less fussy about the forest type than sharp-shins, and are more often "associated with deciduous and mixed forests and open woodland habitats such as woodlots, riparian woodlands, semiarid woodlands of the southwest, and other areas where the woodlands tend to occur in patches and groves or as spaced trees."

In the Northwest and Northeast, conifers are used for nesting (Bent 1937, Reynolds et al. 1982), but elsewhere the preference is for hardwoods (Brown and Amadon 1968). In the Northwest a preference may exist also for the cooler microclimates offered by north and east facing slopes (Reynolds et al. 1982). In that area, the Cooper's hawk is typically found in middle-aged stands, 50 - 60 years in age, whereas the sharp-shin prefers younger stands and the goshawk older ones (Reynolds et al. 1982). That difference might express competitive displacement, because in the East, where the goshawk rarely nests, the Cooper's hawk prefers mature stands (Brown and Amadon 1968).

In some areas the species seems to require large tracts of forests and to avoid human contact, in others they may use small forest tracts, (e.g., British Columbia and Nevada), woodlots (e.g., Ohio) or urban/suburban areas where they seem tolerant of human activities (e.g., British Columbia, Utah, Wisconsin, Indiana) (Hennessy 1978, Herron et al. 1985, Campbell et al 1990, Peterjohn and Rice 1991, Rosenfield et al. 1991).

In New Jersey-New York, nested mostly in mixed deciduous-coniferous forest with eastern hemlock the dominant coniferous species at many sites. Tended to nest in areas with relatively large basal area and more canopy cover. Nests located in live overstory trees (43% conifers), typically within the canopy, and always in dense forest but commonly near wetland openings or source of water, on level ground or lower slopes, typically several hundred meters from paved roads (but sometimes within 100 meters or less). Avoided southern exposures (Reynolds et al. 1982, Bosakowski et al. 1992).

A recent study in Missouri documented numerous Cooper's Hawks nesting in young pine plantations in essentially the same habitat as sharp-shins. Also found that trees with deformed crowns were preferred (Wiggers and Kritz 1991). Rosenfield et al. (1991) report that pine plantations are important habitat for breeding Cooper's hawks throughout the Midwest, and particularly in Wisconsin. See Kennedy (1988) for details on nesting habitat in New Mexico.

NON-BREEDING: Migrates mostly along ridges and coastlines (NGS 1983). Winter habitat is much the same as in the nesting season, although open woodlands and fields may be utilized to a greater extent.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cooper's hawks live in deciduous and mixed forests. They also live in open woodland habitats such as woodlots, riparian woodlands, semi-arid woodlands of the southwest United States, and other areas where woodlands are found in patches.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: savanna or grassland ; chaparral ; forest

Other Habitat Features: suburban ; riparian

  • Johnsgard, P. 1990. Hawks,Eagles, and Falcons of North America. Washington DC: Smithsonian Books.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Northernmost populations migratory (move north mostly March-April, southward late August-early November) but regularly present throughout most of breeding range in winter. Migrates singly or in twos or threes (National Geographic Society 1983). See Palmer (1988) for more information.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Cooper's hawks are predators primarily of birds and small mammals. They also occasionally feed upon reptiles and amphibians. When hunting, Cooper's hawks usually perch in a hidden location and watch for prey. They wait until their prey is unaware of their presence, then quickly swoop down and seize it. Bobwhites, starlings, blackbirds, chipmunks, and squirrels are common prey for Cooper's hawks. Their short, rounded wings make them very maneuverable flyers in dense, forested habitats. These hawks also pursue prey on the ground, half running and half flying. The prey taken by an individual Cooper’s hawk is largely influenced by the size of the bird; larger hawks eat larger prey than smaller hawks.

There is no information available regarding how Cooper's hawks obtain water.

Animal Foods: birds; mammals; amphibians; reptiles

Primary Diet: carnivore (Eats terrestrial vertebrates)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Eats medium-sized birds (e.g., starling, thrush, quail), sometimes small birds and some up to size of adult ruffed grouse, small ground-foraging mammals, occasionally reptiles (especially in southwestern U.S.) and amphibians. Their primary food is other birds; up to 90% of its diet is composed of avian prey, with mid-sized birds such as flickers and starlings being taken preferentially (Kennedy 1980). They are frequently important predators of bobwhites and were at least formerly, before the days of factory farming, raiders of domestic fowl. These food choices have led to a great deal of persecution by humans. Additional foods include small mammals, reptiles, amphibians, and insects (Bent 1937). In the southwest and west mammals and lizards can make up as much as half the food intake (Johnsgard 1990). Young birds comprise a large proportion of the food provided to nestlings. Typically hunts from inconspicuous perch, or uses a longer searching flight. Sometimes attracted to birds at feeders. Birds may not necessarily prevail in the diet (Bielefeldt et al. 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Cooper's hawks eat mostly birds and small mammals. However, they also eat reptiles and amphibians when they are available. When hunting, Cooper's hawks usually perch in a hidden location and watch for prey. When they see prey, quickly swoop down and seize it. Colinus virginianus, Sturnus vulgaris, Agelaius phoeniceus, Tamias striatus, and squirrels are common prey for Cooper's hawks. Their short, rounded wings make them very maneuverable fliers in dense, forested habitats. These hawks also chase prey on the ground by half running and half flying. The prey taken by an individual Cooper’s hawk depends on its size; larger hawks eat larger prey than smaller hawks.

Cooper's hawks obtain water by scooping water up with their beaks and tipping their heads back to drink. They often nest near rivers or streams and have even been seen in backyard bird baths. They likely obtain water from these sources.

Animal Foods: birds; mammals; amphibians; reptiles

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Cooper's hawks impact the populations of the animals they prey on. They are also hosts for several species of parasites, including larval dipterans, mallophagial lice, tapeworms and helminths.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Adults, nestlings and eggs are vulnerable to predation by great horned owls, red-tailed hawks and northern goshawks. Eggs and nestlings are also vulnerable to predation by raccoons and American crows.

Known Predators:

  • red-tailed hawks (Buteo jamaicensis)
  • northern goshawks (Accipiter gentilis)
  • raccoons (Procyon lotor)
  • American crows (Corvus brachyrhynchos)
  • great horned owls (Bubo virginianus)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecosystem Roles

Cooper's hawks impact the populations of the animals they prey on. As high level predators they play an important role in keeping many populations healthy. By keeping prey populations down, birds of prey help them to avoid problems such as disease or food shortage which may occur from overpopulation. They are also hosts for several species of lice and intestinal parasites.

Commensal/Parasitic Species:

  • Internal parasites (Larval dipterans)
  • Mallophagial feather lice
  • Intestinal parasites (Tapeworms)
  • Internal parasites (Helminths)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Adults, nestlings and eggs are vulnerable to predation by Bubo virginianus, Buteo jamaicensis and Accipiter gentilis. Eggs and nestlings are also vulnerable to predation by Procyon lotor and Corvus brachyrhynchos.

Known Predators:

  • Red-tailed hawks (Buteo_jamaicensis)
  • Northern goshawks (Accipiter_gentilis)
  • Raccoons (Procyon_lotor)
  • American crows (Corvus_brachyrhynchos)
  • Great horned owls (Bubo_virginianus)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Accipiter cooperii preys on:
Empidonax minimus
Vireo gilvus
Icterus galbula
Pheucticus ludovicianus
Catharus fuscescens
Poecile atricapillus
Troglodytes aedon
Pipilo
Dumetella carolinensis
Toxostoma rufum
Dendroica petechia
Vireo olivaceus
Carduelis tristis
Turdus migratorius
Geothlypis trichas
Melospiza melodia
Agelaius phoeniceus
Quiscalus quiscula
Cyrtonyx montezumae
Otus trichopsis
Micrathene whitneyi
Colaptes auratus
Bombycilla cedrorum
Auriparus flaviceps
Sitta canadensis
Sitta pygmaea
Dendroica palmarum
Carpodacus mexicanus
Corvus caurinus
Nucifraga columbiana
Spermophilus brunneus
Tamias dorsalis
Tamias merriami

Based on studies in:
Canada: Manitoba (Forest)

This list may not be complete but is based on published studies.
  • Myers, P., R. Espinosa, C. S. Parr, T. Jones, G. S. Hammond, and T. A. Dewey. 2006. The Animal Diversity Web (online). Accessed February 16, 2011 at http://animaldiversity.org. http://www.animaldiversity.org
  • R. D. Bird, Biotic communities of the Aspen Parkland of central Canada, Ecology, 11:356-442, from p. 406 (1930).
  • R. D. Bird, Biotic communities of the Aspen Parkland of central Canada, Ecology, 11:356-442, from p. 410 (1930).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Few data on population densities exist. Craighead and Craighead (1956) found 1554 hectares per pair in 1947-1948 in Michigan. In Maryland a density estimate of 200 hectares per pair was calculated by Stewart and Robbins (1958). Rosenfield et al. (1991) compiled nesting densities from various studies. These densities ranged from a low of 5000 hectares per pair in North Dakota in 1987, to a high of 331 hectares per pair in a pine plantation in southeastern Wisconsin in 1986.

Strongly territorial. Males vigorously defend an area 30 meters in diameter around the nest site although they may forage up to 3.2 kilometers away (Brown and Amadon 1968). Johnsgard (1990) reported home range sizes that ranged from 105 to 784 hectares (the latter was seasonal home range; daily home range was 231 hectares). Nests are typically spaced 2.4 - 5.6 kilometers apart (Brown and Amadon 1968, Reynolds and Wight 1978, Kennedy 1980, Campbell et al 1990) and not usually less than one kilometer apart (Palmer 1988). The smaller sharp-shinned hawk also appears to keep similar distances from Cooper's hawk nests (Brown and Amadon 1968, Reynolds and Wight 1978), indicating interspecific aggression probably related to competition for food. Winter range is larger. Michigan birds ranged over areas of 2.4 - 3.2 kilometers in diameter.

Dispersal range is limited. In Wisconsin, six males dispersed 4 - 35 kilometers (mean 12 kilometers) from natal site to nesting site; one female dispersed 14 kilometers (Rosenfield and Bielefeldt 1992). Hunt by a combination of still-hunting and searching flights along woodland edges and natural routes (Johnsgard 1990).

Birds following inland migration routes apparently migrate over longer distances than those following coastal routes, and tend to have longer wings and tails, creating lower "flight-surface loading." This is thought to be an adaptation to the longer flight distances, more open country, and stronger thermal updrafts encountered along the inland routes (Smith et al. 1990).

Mortality appears to be quite high during the birds' first winter, approaching 78% as opposed to only 34% per year for the adults 2 to 8 years old (Henny and Wight 1972). The maximum recorded lifespan is 8 years (Henny and Wight 1972). Life history traits place it intermediate for population turnover rate between the larger goshawk and smaller sharp-shinned hawk. This may partially explain the slower recovery of Cooper's from a population crash in the 1950s-1960s compared to sharp-shinned hawks (Bednarz et al. 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Cooper's Hawks communicate using vocalizations and displays. They probably use vocalizations more than visual displays, because their dense forested or woodland habitat prevents visual displays from being seen very far away. One study recorded 42 different calls made by females, 22 by males, and 14 by juveniles. Males have higher pitched voices than females.

Communication Channels: visual ; acoustic

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Communication and Perception

Cooper's hawks communicate using vocalizations and displays. They probably use vocalizations more than visual displays, because their dense forest habitat makes it difficult to see visual displays from far away. It is estimated that there are 42 different calls made by females, 22 by males, and 14 by juveniles. Males have higher pitched voices than females. Cooper's hawks rely on their amazing eyesight to locate prey.

Communication Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Cooper's Hawks are known to live as long as 12 years in the wild. However, one study showed that the average age at death was as low as 16.3 months for wild Cooper's hawks.

Range lifespan

Status: wild:
12 (high) years.

Average lifespan

Status: wild:
1.3 years.

Average lifespan

Status: wild:
244 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan/Longevity

Cooper's hawks are known to live as long as 12 years in the wild. Like many animals, Cooper's hawks are most vulnerable when they are young. Many Cooper's hawks do not survive long after they reach 1 year old.

Range lifespan

Status: wild:
12 (high) years.

Average lifespan

Status: wild:
1.3 years.

Average lifespan

Status: wild:
244 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 12 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Cooper’s hawks are monogamous, and many pairs mate for life. Pairs breed once per year and raise one brood per breeding season. The male chooses the nest site, but the female does the majority of the nest-building. Courtship activities include stylized flights with the wings held in a deep arc. Cooper’s hawks are territorial, and defend a territory around the nest.

Courtship activities include flight displays. For example, the male of a pair will fly around the female exposing his expanded under tail coverts to her. The male raises his wings high above the back and flies in a wide arc with slow, rhythmic flapping. Typically these display flights occur on bright, sunny days in midmorning, and begin with both birds soaring high on thermals. The male and female may both participate in courtship flights. The male begins by diving toward the female, followed by a very slow-speed chase. Both birds move with a slow and exaggerated wingbeats alternated with glides in which the wings are held at a dihedral angle and the white under tail coverts are conspicuously spread.

Mating System: monogamous

Cooper's hawks begin breeding as early as March. Most individuals do not breed until they are at least two years old. Pairs build nests made of sticks and twigs and lined with bark, conifer needles and down. Males select most of the nest materials and do most of the nest building, although females contribute pieces of material occasionally. The female lays 3 to 6 (usually 4 to 5) bluish to greenish-white eggs that are usually spotted and soon become stained in the nest. The eggs hatch after 32 to 36 days, during which time they are incubated primarily by the female. During this time, the male provides most of the food for the female. After the eggs hatch, both parents tend the young who leave the nest after 27 to 34 days. Parents continue to provide food until the young become independent at about 8 weeks.

Breeding interval: Cooper's hawks breed once yearly

Breeding season: Cooper's hawks begin breeding as early as March.

Range eggs per season: 3 to 6.

Range time to hatching: 32 to 36 days.

Range fledging age: 27 to 34 days.

Average time to independence: 2 months.

Range age at sexual or reproductive maturity (female): 1 (low) years.

Average age at sexual or reproductive maturity (female): 2 years.

Range age at sexual or reproductive maturity (male): 2 (low) years.

Average age at sexual or reproductive maturity (male): 2 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Average eggs per season: 4.

Both male and female Cooper’s hawks care for their chicks. During incubation, the female spends most of the time protecting the eggs and nest, and the male provides nearly all of her food. After hatching, both parents tend the young. The male continues to do most of the hunting during the hatchling stage. Both parents continue to provide food to the chicks until they become independent at about 8 weeks.

Parental Investment: altricial ; pre-fertilization (Provisioning); pre-hatching/birth (Provisioning: Male, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female)

  • Chipper Woods Bird Observatory, 1998. "Cooper's Hawk" (On-line). Accessed July 10, 2000 at http://www.wbu.com./chipperwoods/photos/coophawk.htm.
  • Ehrlich, P., D. Dobkin, D. Wheye. 1988. The Birder's Handbook: A Field Guide to the Natural History of North American Birds. New York: Simon and Schuster.
  • Johnsgard, P. 1990. Hawks,Eagles, and Falcons of North America. Washington DC: Smithsonian Books.
  • Peterson, R., V. Peterson. 2002. A field guide to the birds of Eastern and Central North America, Fifth Edition. New York: Houghton Mifflin Company.
  • Rosenfield, R., J. Bielefeldt. 1993. Cooper's Hawk (Accipiter cooperii). A Poole, F Gill, eds. The Birds of North America, Vol. 75. Philadelphia, PA and Washington DC: The Academy of Natural Sciences and The American Ornithologist's Union.
  • Stoper, T., R. Usinger. 1968. Sierra Nevada Natural History. Los Angelos: University of California Press.
  • Whitfield, P. 1984. Macmillan Illustrated Animal Encyclopedia. New York: Macmillan Publishing Co..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The breeding season usually begins in early April and extends through May and June (Bent 1937, Brown and Amadon 1968). The annual molt begins in late June but can occur as late as October (Bent 1937). Southward migration commences in the northern states in late August, with September being the peak month; it is essentially over by November. Northward migration occurs from late February to early April (Brown and Amadon 1968).

The male does most of the nest building and occasionally some of the incubation; most of the incubation is done by the female, which seldom leaves the nest before the young have fledged (Brown and Amadon 1968). During the pre-fledging period the male provides both the female and the young with food, while both parents feed the young for up to four weeks after they leave the nest (Brown and Amadon 1968).

Only one brood is raised each year. The normal clutch is four-five eggs, with clutches of three and six being rarely observed (Bent 1937). A national average has been calculated at 3.5 eggs (Bednarz et al. 1990). Replacement clutches are laid if the first set is lost, and laying can be delayed under conditions of low food availability (Bent 1937, Snyder and Wiley 1976).

Hatching success data are limited, but in areas unaffected by DDT contamination the average hatching rate ranges from about 70% to 83% (Craighead and Craighead 1956, Johnsgard 1990), with some further reduction in the brood occurring after hatching. Normal fledging success rates range from 2.1 to 3.5 for pairs with successful nests (Craighead and Craighead 1956, Schriver 1969, Henny and Wight 1972, Reynolds and Wight 1978, Herron et al. 1985); roughly 80% of nests produce at least one fledgling (Henny and Wight 1972). In areas affected by DDT poisoning these figures were reported to be dramatically reduced.

The young fledge one month after hatching, the males leaving the nest three-four days earlier than the larger females. They remain dependent on their parents until they are eight weeks of age and have learned to forage on their own (Brown and Amadon 1968). Only about 19% of the birds breed in their first year. Most nest by the second year and continue breeding throughout the rest of their lives.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cooper’s hawks are monogamous, and many pairs mate for life. Pairs breed once per year and raise one brood per breeding season. The male chooses the nest site, but the female does most of the nest-building. Courtship includes flight displays with wings held in a deep arc shape. Cooper’s hawks are territorial, and defend a territory around the nest.

Courtship displays include flight displays. For example, the male will fly around the female showing his under tail feathers to her. He raises his wings high above his back and flies in a wide arc with slow, rhythmic flapping. These display flights usually occur on bright, sunny days in mid-morning, and begin with both birds soaring high on warm rising air. The male and female may both participate in courtship flights. The male begins by diving toward the female, followed by a very slow-speed chase. Both birds move with a slow and exaggerated wingbeats alternated with glides.

Mating System: monogamous

Cooper's hawks begin their breeding season early in the spring. As early as March, they build nests made of sticks and twigs and lined with bark, conifer needles and down. The female lays 3 to 6 (usually 4 to 5) bluish to greenish-white eggs that are usually spotted. The eggs hatch after 32 to 36 days. The female does most of the incubating, and the male provides food for her. After the eggs hatch, both parents care for the young, who leave the nest after 27 to 34 days when they learn to fly. The parents continue to provide food to the chicks until they learn to feed themselves at about 8 weeks old. Most Cooper's hawks do not breed until they are at least two years old.

Breeding interval: Cooper's hawks breed once yearly.

Breeding season: Cooper's hawks begin breeding as early as March.

Range eggs per season: 3 to 6.

Average eggs per season: 4 to 5.

Range time to hatching: 32 to 36 days.

Range fledging age: 27 to 34 days.

Average time to independence: 2 months.

Range age at sexual or reproductive maturity (female): 1 (low) years.

Average age at sexual or reproductive maturity (female): 2 years.

Range age at sexual or reproductive maturity (male): 2 (low) years.

Average age at sexual or reproductive maturity (male): 2 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Average eggs per season: 4.

Both male and female Cooper’s hawks care for their chicks. The female performs most of the egg incubation and spends nearly all of her time warming and protecting the nest. The male will protect the nest by defending the area from predators. While the female broods the nest, she has little time to catch her own food so the male will bring her prey that he has caught. After the eggs hatch, both parents will brood, feed, and protect the young chicks. The male however, continues to do most of the hunting. The chicks learn to fly after a few weeks and will leave the nest but remain with their parents. The parents will continue to feed and protect the fledgling chicks until they learn how to feed themselves and survive on their own.

Parental Investment: altricial ; male parental care ; female parental care ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female)

  • Chipper Woods Bird Observatory, 1998. "Cooper's Hawk" (On-line). Accessed July 10, 2000 at http://www.wbu.com./chipperwoods/photos/coophawk.htm.
  • Ehrlich, P., D. Dobkin, D. Wheye. 1988. The Birder's Handbook: A Field Guide to the Natural History of North American Birds. New York: Simon and Schuster.
  • Johnsgard, P. 1990. Hawks,Eagles, and Falcons of North America. Washington DC: Smithsonian Books.
  • Peterson, R., V. Peterson. 2002. A field guide to the birds of Eastern and Central North America, Fifth Edition. New York: Houghton Mifflin Company.
  • Rosenfield, R., J. Bielefeldt. 1993. Cooper's Hawk (Accipiter cooperii). A Poole, F Gill, eds. The Birds of North America, Vol. 75. Philadelphia, PA and Washington DC: The Academy of Natural Sciences and The American Ornithologist's Union.
  • Stoper, T., R. Usinger. 1968. Sierra Nevada Natural History. Los Angelos: University of California Press.
  • Whitfield, P. 1984. Macmillan Illustrated Animal Encyclopedia. New York: Macmillan Publishing Co..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Accipiter cooperii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNNNTTTACCTAATCTTCGGCGCTTGAGCTGGCATAGTAGGTACTGCCCTTAGCCTCCTCATCCGCGCAGAACTCGGCCAACCAGGCACACTACTAGGCGACGACCAAATCTACAATGTAATCGTCACCGCACATGCCTTCGTAATAATCTTCTTTATAGTTATACCAATCATAATCGGAGGCTTCGGAAATTGACTCGTTCCACTCATAATTGGCGCCCCCGACATAGCCTTCCCACGCATAAACAACATAAGTTTCTGATTACTACCCCCATCCTTCCTCCTCCTACTAGCCTCCTCAACAGTAGAAGCAGGAGCTGGTACAGGATGAACTGTTTACCCTCCATTAGCTGGTAATATAGCCCACGCCGGAGCCTCAGTAGACCTAGCTATCTTCTCTTTACATCTAGCCGGAATCTCATCCATCCTAGGAGCAATCAACTTCATCACAACCGCCATCAACATAAAACCCCCAGTCCTCTCCCAATACCAAACACCCCTATTCGTATGATCTGTCCTCATCACCGCCGTCCTACTACTGCTCTCACTTCCAGTCCTAGCTGCTGGCATTACTATACTACTAACAGATCGAAACCTCAACACAACATTTTTCGACCCTGCCGGTGGAGGTGATCCTATCCTATACCAACATCTTTTCTGATTCTTTGGCCACCCAGAAGTCTACATCCTAATATCT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Accipiter cooperii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5