Articles on this page are available in 1 other language: Spanish (18) (learn more)

Overview

Brief Summary

Buteo jamaicensis

A large (19-25 inches) hawk, the Red-tailed Hawk is most easily identified by its dark brown back, pale underparts, and rusty-red tail visible from above or below. In some parts of this species’ range, exceptionally light or dark subspecies occur, having more or less pigment in the back, breast, and tail than the nominative subspecies. Male and female Red-tailed Hawks are similarly-plumaged in all seasons; however, like most species of raptors, females are larger than males. The Red-tailed Hawk breeds from Alaska and northern Canada south through the United States, the West Indies, Mexico, and parts of Central America. In winter, northerly-breeding populations migrate south to the southern half of the U.S. Southerly-breeding populations migrate short distances, if at all. Red-tailed Hawks are birds of semi-open country. This species inhabits open woodland, shrubby fields, and even urban areas where food is plentiful. Red-tailed Hawks primarily eat small mammals, including lemmings, mice, and voles, but may eat small birds and reptiles when the opportunity presents itself. Red-tailed Hawks are most easily seen soaring over open habitat while scanning the ground for prey, dropping down to capture it with their talons. With the aid of binoculars, it may also be possible to see individual Red-tailed Hawks perching in trees or tall posts near their hunting grounds. This species is primarily active during the day.

Threat Status: Least Concern

  • Buteo jamaicensis. Xeno-canto. Xeno-canto Foundation, n.d. Web. 20 July 2012. .
  • Red-tailed Hawk (Buteo jamaicensis). The Internet Bird Collection. Lynx Edicions, n.d. Web. 20 July 2012. .
  • eBird Range Map - Red-tailed Hawk. eBird. Cornell Lab of Ornithology, N.d. Web. 20 July 2012. .
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Institution

Supplier: DC Birds

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

The Red-tailed Hawk is a bird of prey, one of three species colloquially known in the United States as the "chickenhawk," though it rarely preys on standard sized chickens (All About Birds). It breeds throughout most of North America, from western Alaska and northern Canada to as far south as Panama and the West Indies, and is one of the most common buteos in North America. Red-tailed Hawks can acclimate to all the biomes within its range. There are fourteen recognized subspecies, which vary in appearance and range. It is one of the largest members of the genus Buteo in North America, typically weighing from 690 to 1600 grams (1.5 to 3.5 pounds) and measuring 45–65 cm (18 to 26 in) in length, with a wingspan from 110 to 145 cm (43 to 57 in). The Red-tailed Hawk displays sexual dimorphism in size, with females averaging about 25% heavier than males (Preston and Beane 1993).

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

© Wikipedia editors and contributors

Supplier: Cyndy Parr

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Red-tailed hawks are native only to the Nearctic region. They are found throughout the United States and Canada, and into Mexico and Central America. Many birds are year round occupants although the birds of the far north migrate south during the fall to escape the harsh winter.

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 2 people

Average rating: 3.75 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) BREEDS: western and central Alaska, central Yukon, western Mackenzie, northern Saskatchewan, northern Manitoba, central Ontario, southern Quebec, New Brunswick, Prince Edward Island, and Nova Scotia south to southeastern Alaska, Baja California, Sonora, Chihuahua, Nuevo Leon, southern Texas, Gulf Coast, and Florida, and highlands of Middle America to Costa Rica and western Panama (east to Canal Zone); in Tres Marias and Socorro islands off western Mexico; and in northern Bahamas (Grand Bahama, Abaco, Andros), Greater Antilles, and northern Lesser Antilles (Saba south to Nevis) (AOU 1983). WINTERS: southern Canada south through remainder of breeding range, also in lowlands of Central America. In the U.S., most abundant in winter in California-western Nevada and in the farming and ranching region of the central U.S. (Root 1988). Accidental in England and Bermuda (AOU 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Red-tailed hawks are native only to the Nearctic region. They are found throughout the United States and Canada, and into Mexico and Central America. Many birds are year round occupants although the birds of the far north migrate south during the fall to escape the harsh winter.

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red-tailed hawks breed from central Alaska, the Yukon, and the Northwest
Territories east to southern Quebec and the Maritime Provinces and south
to Florida, the West Indies, and Central America.  They winter from
southern Canada south throughout the remainder of the breeding range
[1,8,13].

Buteo jamaicensis ssp. alascensis breeds (probably resident) from
southeastern coastal Alaska (Yakutat Bay) to Queen Charlotte Islands and
Vancouver Island, British Columbia [49].

Eastern red-tailed hawks breed from southern Ontario, southern Quebec,
Maine, and Nova Scotia south through eastern Nebraska, eastern Kansas,
and eastern Oklahoma to eastern Texas, Louisiana, Mississippi, Alabama,
and northern Florida.  They winter from eastern Nebraska, northeastern
Iowa, southern Michigan, southern Ontario, central New York, and
southern Maine south to the Gulf coast and southern Florida.  Occasional
breeding occurs from northern Minnesota to northern New England [49].

Western red-tailed hawks breed from central interior Alaska, the Yukon,
the Northwest Territories, and Saskatchewan south to Baja California,
Sonora, and western New Mexico.  They range east to Colorado, Wyoming, and
Montana and to northeastern Manitoba, south-central Ontario, central and
eastern Quebec, Prince Edward Island, and Cape Breton Island.  Western
red-tailed hawks winter from southwestern British Columbia to southern
Minnesota south and southwest to Guatemala and northern Nicaragua [49].

Buteo jamaicensis ssp. fuertesi breed from northern Chihuahua to Brewster
County, Kerr County, and Corpus Christi in southern Texas south to
south-central Nuevo Leon.  They winter in central Sonora, southwestern
Arizona, New Mexico, and southern Louisiana [49].

Harlani red-tailed hawks breed from the Valley of the Yukon and the
Mount Logan area, Alaska, to northern British Columbia east of the Coast
Ranges and southeast to the Red Deer region of Alberta.  They winter from
Kansas, southern Missouri, and Arkansas south to Texas and Louisiana
[49].

Krider's red-tailed hawks breed from southern Alberta, southern
Saskatchewan, southern Manitoba, and extreme western Ontario south to
south-central Montana, Wyoming, western Nebraska, ane western Minnesota.
They winter from South Dakota and southern Minnesota south to Arizona,
New Mexico, Durango, Zacatecas, Texas and Louisiana [49].

Florida red-tailed hawks are year-round residents in peninsular Florida
north to Tampa Bay and the Kissimmee Prairie, formerly to San Mateo and
Cedar Keys [49].

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Regional Distribution in the Western United States

More info on this topic.

This species can be found in the following regions of the western United States (according to the Bureau of Land Management classification of Physiographic Regions of the western United States):

    1  Northern Pacific Border
    2  Cascade Mountains
    3  Southern Pacific Border
    4  Sierra Mountains
    5  Columbia Plateau
    6  Upper Basin and Range
    7  Lower Basin and Range
    8  Northern Rocky Mountains
    9  Middle Rocky Mountains
   10  Wyoming Basin
   11  Southern Rocky Mountains
   12  Colorado Plateau
   13  Rocky Mountain Piedmont
   14  Great Plains
   15  Black Hills Uplift
   16  Upper Missouri Basin and Broken Lands

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Occurrence in North America

AL AK AZ AR CA CO CT DE FL GA
HI ID IL IN IA KS KY LA ME MD
MA MI MN MS MO MT NE NV NH NJ
NM NY NC ND OH OK OR PA RI SC
SD TN TX UT VT VA WA WV WI WY


AB BC MB NB NF NT NS ON PE PQ
SK YT



MEXICO

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Red-tailed hawks are 48 to 65 centimeters in length. Their wingspan is approximately 4 feet, or 122 centimeters. Females and males are similar in appearance, but females are 25% larger than males. This kind of sexual dimorphism, where females are larger than males, is common in birds of prey. Mass is reported from 795 to 1224 grams, with mass varying by sex, season, and geographically. Red-tailed hawks range from light auburn to deep brown in color. Their underbelly is lighter than the rest of the body, with a dark band across it. The cere (the soft skin at the base of the beak), the legs and the feet are all yellow. The tail is brownish-red, and it is this trait that gives red-tailed hawks their name.

Immature red-tailed hawks look similar to adults, but... Immatures also have yellowish-gray eyes that become dark brown as adults.

There are at least 14 subspecies of Buteo jamaicensis. These subspecies are separated based differences in their color and differences in where they breed and spend the winter.

Range mass: 795 to 1224 g.

Range length: 45 to 65 cm.

Average wingspan: 122 cm.

Other Physical Features: endothermic ; bilateral symmetry ; polymorphic

Sexual Dimorphism: female larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Red-tailed hawks average 48 to 65 centimeters in length. Their wingspan is approximately 4 feet, or 122 centimeters. There is sexual dimorphism in size: females are 25% larger than males. This kind of sexual dimorphism, where females are larger than males, is common in birds of prey.

Red-tailed hawk plumage ranges from light auburn to deep brown. The underbelly is lighter than the rest of the body, with a dark belly band across it. The cere (the soft skin at the base of the beak), the legs, and the feet are all yellow. The tail is uniformly red, and it is this trait that gives red-tailed hawks their name.

Immature red-tailed hawks look similar to adults. One difference is that immatures have yellowish-gray eyes that become dark brown as adults.

Range mass: 795 to 1224 g.

Range length: 45 to 65 cm.

Average wingspan: 122 cm.

Other Physical Features: endothermic ; bilateral symmetry ; polymorphic

Sexual Dimorphism: female larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 56 cm

Weight: 1224 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red-tailed hawks inhabit a wide range of habitats over a wide range of altitudes. These habitats are typically open areas with scattered, elevated perches, and include scrub desert, plains and montane grasslands, agricultural fields, pastures, urban parks, patchy coniferous and deciduous woodlands, and tropical rainforests. Red-tailed hawks prefer to build their nests at the edge of forests, in wooded fence rows, or in large trees surrounded by open areas.

Habitat Regions: temperate ; tropical ; terrestrial

Terrestrial Biomes: desert or dune ; savanna or grassland ; forest ; rainforest ; scrub forest

Other Habitat Features: urban ; suburban ; agricultural ; riparian

  • Preston, C., R. Beane. 1993. Red-tailed hawk (Buteo jamaicensis). Pp. 1-24 in A Poole, F Gill, eds. The Birds of North America, Vol. 52. Washington DC and Philadelphia, PA: The Academy of Natural Sciences and The American Ornithologists' Union.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Wide variety of open woodland and open country with scattered trees, rarely in denser forest (AOU 1983), but nests in forest and takes prey from forest canopy in Puerto Rico (Recher and Recher 1966, Santana 1988). Elevated perches are important element of habitat.

Nests in trees to 37 m above ground, frequently high in tallest tree near edge of woods; also, in treeless country, in top of shrub, cactus, or on cliff. Often returns to same nesting area in successive years.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red-tailed hawks live in a variety of habitats. In their habitat, they need open areas for hunting and several scattered perches. Some of the habitats that red-tailed hawks live in are scrub desert, grasslands, farm fields, pastures, parks, woodlands, and tropical rainforests. Red-tailed hawks prefer to build their nests at the edge of forests, in wooded fence rows, or in large trees surrounded by open areas.

Habitat Regions: temperate ; tropical ; terrestrial

Terrestrial Biomes: desert or dune ; savanna or grassland ; forest ; rainforest ; scrub forest

Other Habitat Features: urban ; suburban ; agricultural ; riparian

  • Preston, C., R. Beane. 1993. Red-tailed hawk (Buteo jamaicensis). Pp. 1-24 in A Poole, F Gill, eds. The Birds of North America, Vol. 52. Washington DC and Philadelphia, PA: The Academy of Natural Sciences and The American Ornithologists' Union.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cover Requirements

More info for the terms: cover, tree

Red-tailed hawk nests are generally built on sites that provide a
commanding view of the area and unobstructed access to the nest.  Nests
are typically high in a tree that is taller than those surrounding it.
Some researchers have found that red-tailed hawk nests are often located
well up a slope or on a ridge or hilltop [38,44].  However, Speiser and
Bosakowski [44], reported that in the highlands of southeastern New
York
and northern New Jersey red-tailed hawks most often nested between lower
and middle slopes, seldom near the top of a slope and never directly on
a ridgetop.  Red-tailed hawks seem to prefer trees with open crowns
[38].  Roost trees for raptors are usually large enough to provide
safety from any predatory threat from the ground.  They are typically
the largest trees in the stand; the crown near the top or the middle
portion of the tree is open and have stout lateral limbs with easy
access [50].  Red-tailed hawks are probably more efficient predators in
open areas than in areas with high vegetative cover.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Preferred Habitat

More info for the terms: cacti, hardwood, shrubs, tree, tundra

Red-tailed hawks occupy a wide variety of open to semiopen habitats.
They generally avoid tundra and dense, unbroken woodland [1,9,25,13].
Open to semiopen coniferous, deciduous and mixed woodlands, woodland
edges, grasslands, parklands, rangelands, river bottomlands, and
agricultural fields with scattered trees are preferred.  Forest
clearings, alpine meadows, estuaries, and marshes are also commonly used
[6,8,22,34,39].  Hardwood draws surrounded by native prairie are
important habitats in the Great Plains [9].  In Wyoming and Montana,
red-tailed hawks nested in several habitats, but nests were most
numerous in riparian zones.  Upland draws with adjacent grassland or
agricultural tracts were also commonly used [51].

Nesting habitat - Red-tailed hawks usually nest in a tall tree in or at
the edge of woodlands, or in an isolated tree in an open area [1,9,13].
Red-tailed hawks frequently select the largest and tallest tree
available [1,13].  In treeless areas red-tailed hawks nest on rocky
cliffs or talus slopes, or in shrubs or cacti [13,28].  In the Sonoran
Desert, red-tailed hawks often nest in large saguaro (Carnegiea
gigantea) with projecting limbs [38].  Red-tailed hawks also nest on
artificial nest structures, the crossbars of utility poles, and towers
[25,38,44].  They sometimes add to an existing raven, crow (Corvus
spp.), gray squirrel (Sciurus spp.), or buteo (Buteo spp.) nest [38].
The nest is generally constructed next to the trunk of a tree in a
crotch or fork from 30 to 90 feet (9-27 m) above the ground [13,46].
Where tall trees are unavailable nests may be located almost on the
ground.  Red-tailed hawk nests are at most 6 feet (0.9 m) above the
ground in paloverde (Cercidium spp.) [38].  Nests are often reused from
year to year provided that the nests are not occupied by earlier nesting
raptors [20,51].  The mean distance between occupied nests in Wyoming
and Montana was 1.5 miles (2.4 km) [51].

Red-tailed hawks nest in a wide variety of tree species [8,43,44,45,51].
In central Missouri, 99 percent of red-tailed hawk nests were in
deciduous hardwoods.  Sycamore (Platanus occidentalis) was the most
frequently selected species (40%).  Other species included white
oak (Quercus alba), 32 percent; black oak (Q. velutina), 19.1 percent;
shingle oak (Q. imbricaria), 1.9 percent; eastern redcedar (Juniperus
virginiana), 1.9 percent; red oak (Q. rubra), 0.9 percent; American elm
(Ulmus americana), 0.9 percent; green ash (Fraxinus pennsylvanica), 0.9
percent; shagbark hickory (Carya ovata), 0.9 percent; mockernut hickory
(C. tomentosa), 0.9 percent; and eastern cottonwood (Populus
deltoides), 0.9 percent [45].

In Snohomish County, Washington, only black cottonwood (Populus
trichocarpa) and red alder (Alnus rubra) were utilized for nesting. No
nests were found in conifers [43].  In the highlands of southeastern New
York and northern New Jersey, red-tailed hawks built nests in 10
different species of trees, with the majority in oaks (82%) [44].  In
Wyoming and Montana, the majority (51%)of red-tailed hawk nests were
found in coniferous trees.  Forty-seven percent of the nests were found
in deciduous trees and 2 percent were located on cliffs [51].  In
British Columbia, coniferous trees (48%; 8 species) were used slightly
more that deciduous trees (44%; 4 species).  Black cottonwood (38%),
Douglas-fir (Pseudotsuga menziesii) (19%), and ponderosa pine (Pinus
ponderosa) (19%) were used most often [8].
 
Only 13 percent of the red-tailed hawk nests in a study area in
Wisconsin were located in closed-canopy woodlots.  Fifty-eight percent
of the nests were located in open groves, generally less than 1 acre
(0.4 ha) in size.  Twenty-nine percent were located in isolated trees
along fencelines and ditchbanks. The majority of the nest trees were on
well-drained upland sites [19].  Houston and Bechard [21] documented the
increase of nesting red-tailed hawks following the expansion of trees
into the prairie regions of Saskatchewan [44].

Foraging habitat - Red-tailed hawks generally forage in open habitats
containing lagomorphs, small rodents, and snakes.  During the nesting
season red-tailed hawks usually forage within 1.9 miles (3 km) of the
nest [25].  They are often observed hunting in clearcuts and
non-forested areas [35].  Red-tailed hawks usually search for prey from
elevated perches [20,23,38].  Consequently, they commonly occupy areas
that provide a relative abundance of potential perching sites [23].
James [23] found that 40 percent or more or the average red-tailed hawk
home range contained at least 10 perches per 40 acres (16.2 ha).  Snags
are commonly used for perches [12,14,31].  Red-tailed hawks in central
Iowa tend to select perches in groves of trees and along woodland edges
[53].  Foraging habitat in the Midwest is limited by large expanses of
cereal crops [9].

Winter habitat - Winter habitat for red-tailed hawks is generally the
same as the nesting habitat, except that high elevation areas are not
used [25].  Wintering red-tailed hawks in Illinois avoided plowed fields
and showed a preference for high perches in areas with groups of trees
or small woodlots [9].

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associated Plant Communities

More info for the term: tundra

Red-tailed hawks occur in nearly every open to semiopen plant community
in North America [8,25].  They avoid tundra and dense forests [1,25].

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Cover Types

More info on this topic.

This species is known to occur in association with the following cover types (as classified by the Society of American Foresters):

More info for the term: cover

   Red-tailed hawks probably occur in most SAF Cover Types

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Plant Associations

More info on this topic.

This species is known to occur in association with the following plant community types (as classified by Küchler 1964):

   Red-tailed hawks probably occur in most Kuchler Plant Associations

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Ecosystem

More info on this topic.

This species is known to occur in the following ecosystem types (as named by the U.S. Forest Service in their Forest and Range Ecosystem [FRES] Type classification):

FRES10 White-red-jack pine
FRES11 Spruce-fir
FRES12 Longleaf-slash pine
FRES13 Loblolly-shortleaf pine
FRES14 Oak-pine
FRES15 Oak-hickory
FRES16 Oak-gum-cypress
FRES17 Elm-ash-cottonwood
FRES18 Maple-beech-birch
FRES19 Aspen-birch
FRES20 Douglas-fir
FRES21 Ponderosa pine
FRES22 Western white pine
FRES23 Fir-spruce
FRES24 Hemlock-Sitka spruce
FRES25 Larch
FRES26 Lodgepole pine
FRES27 Redwood
FRES28 Western hardwoods
FRES29 Sagebrush
FRES30 Desert shrub
FRES31 Shinnery
FRES32 Texas savanna
FRES33 Southwestern shrubsteppe
FRES34 Chaparral-mountain shrub
FRES35 Pinyon-juniper
FRES36 Mountain grasslands
FRES37 Mountain meadows
FRES38 Plains grasslands
FRES39 Prairie
FRES40 Desert grasslands
FRES41 Wet grasslands
FRES42 Annual grasslands
FRES44 Alpine

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Northern populations mainly migratory (some breeders resident on or near territories all year), generally arrive in northern breeding areas in March and April (yearlings may still be migrating as late as May and June), depart by September-October (Bent 1937), may continue southward movement into December. Migrations may be influenced by food supply. Most migrants from north migrate no farther south than northern Mexico (Palmer 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Red-tailed hawks feed on a wide variety of prey, using their powerful claws as weapons. Eighty to eighty-five percent of their diet consists of small rodents. Mammals as large as eastern cottontail rabbits may also taken. Reptiles and other birds make up the rest of the diet. Male red-winged blackbirds are common prey because they are so visible when guarding their nests. Red-tailed hawks do most of their hunting from a perch. They are not known to store food.

Animal Foods: birds; mammals; reptiles

Primary Diet: carnivore (Eats terrestrial vertebrates)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Opportunistic. Rodents, lagomorphs, birds, and reptiles common in diet but also eats various other vertebrates and sometimes invertebrates as available. Among several hunting methods, perch-and-wait most common and yields greatest success (Palmer 1988). Also perches and hunts along highways.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Red-tailed hawks feed on a wide variety of prey, using their powerful claws as weapons. Eighty to eighty-five percent of their diet consists of small Rodentia. Mammals as large as Sylvilagus floridanus may also taken. Squamata and other Aves make up the rest of the diet. Male Agelaius phoeniceus are common prey because they are so visible when guarding their nests. Red-tailed hawks do most of their hunting from a perch. They are not known to store food.

Animal Foods: birds; mammals; reptiles

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

More info for the term: tree

Red-tailed hawks are versatile, opportunistic predators [38].  Prey
items of red-tailed hawks are numerous.  Generally, any animal the size
of a jackrabbit (Lepus spp.) or smaller, including domestic animals, is
potential prey.  Red-tailed hawks primarily eat small mammals but also
eat birds, reptiles, and some insects [13,16,20,38].  In Wyoming,
Wisconsin, and Michigan, researchers found that mammals accounted for 93
percent, 85 percent, and 40 percent, respectively, of the prey species
taken [22].

Some prey items reported to be taken by red-tailed hawks include meadow
voles (Microtus pennsylvanicus), red-backed voles (Clethrionomys
gapperi), short-tail shrews (Blarina brevicauda), deer mice (Peromyscus
maniculatus), chipmunks (Tamias spp.), tree squirrels (Sciurus spp.),
ground squirrels (Citellus spp.), pikas (Ochotona princeps), prairie
dogs (Cynomys spp.), jackrabbits, cottontails (Sylvilagus spp.), skunks
(Mephitis spp. and Spilogale spp.), raccoons (Procyon lotor), woodchucks
(Marmota spp.), ring-necked pheasants (Phasianus colchicus), grouse, and
various songbirds [5,20,22,30,38].

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Red-tailed hawks play an important role in local ecosystems by helping to control the populations of small mammals, including rodents and rabbits. They also provide habitat for some small bird species, including house sparrows, that live in active red-tailed hawk nests.

Red-tailed hawks have antagonistic relationships with many bird species. Some smaller bird species mob hawks. Red-tailed hawks also steal prey and have prey stolen by other large birds, including golden eagles, bald eagles and ferruginous hawks.

Ecosystem Impact: creates habitat

Commensal/Parasitic Species:

  • house sparrow

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Adult red-tailed hawks are large formidable birds, and have few predators. Most predation on this species occurs to eggs and nestlings. Great horned owls are known predators of red-tailed hawk nestlings. Corvids are known predators of eggs and nestlings.

Known Predators:

  • great horned owls (Bubo virginianus)
  • crows (Corvus)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecosystem Roles

Red-tailed hawks play an important role in local ecosystems by helping to control the populations of small mammals, including rodents and rabbits. They also provide habitat for some small bird species, including Passer domesticus, that live in active red-tailed hawk nests.

Some smaller bird species mob hawks. Red-tailed hawks also steal food and have food stolen by other large birds, including Aquila chrysaetos, Haliaeetus leucocephalus and Cynomys ludovicianus.

Ecosystem Impact: creates habitat

Commensal/Parasitic Species:

  • Passer domesticus

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Adult red-tailed hawks are large formidable birds, and have few predators. Most predation on this species occurs to eggs and nestlings. Bubo virginianus are known predators of red-tailed hawk nestlings. Corvus are known predators of eggs and nestlings.

Known Predators:

  • great horned owls (Bubo_virginianus)
  • crows (Corvus)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predators

Information was not found in the literature regarding predation on
red-tailed hawks or their clutches.  However, species that kill other
raptors and destroy their clutches probably also kill  red-tailed
hawks.  Some raptor predators include great horned owls (Bubo
virginianus) and golden eagles (Aquila chrysaetos).  Other potential
predators include coyotes (Canis latrans), bobcats (Lynx rufus), skunks,
and crows.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Buteo jamaicensis preys on:
Spermophilus richardsonii
Microtus
Spermophilus tridecemlineatus
Thomomys
Peromyscus
Sciurus aberti
Spermophilus
Tamias
Sylvilagus
Gekkonidae
Phrynosoma
Uta
Herpestes auropunctatus
Scolopendra alternans
Melanerpes portoricensis
Margarops fuscatus
Anolis cuvieri
Anolis evermanni
Anolis stratulus
Anolis gundlachi
Alsophis portoricensis
Icterus dominicensis
Araneae
Mimetes portoricensis
Vireo altiloquus
Epilobocera situatifrons
Rattus rattus
Bufo marinus
Dendroica angelae
Coereba flaveola
Spindalis zena
Columba squamosa
Amazona vittata
Euphonia musica
Larus californicus
Asio flammeus
Corvus caurinus
Nucifraga columbiana
Neurotrichus gibbsii
Spermophilus beecheyi
Spermophilus brunneus
Spermophilus lateralis
Spermophilus washingtoni
Microtus xanthognathus
Microtus californicus
Neotoma lepida
Falcipennis canadensis

Based on studies in:
Canada: Manitoba (Grassland)
USA: Arizona (Forest, Montane)
USA: Arizona, Sonora Desert (Desert or dune)
Puerto Rico, El Verde (Rainforest)

This list may not be complete but is based on published studies.
  • D. I. Rasmussen, Biotic communities of Kaibab Plateau, Arizona, Ecol. Monogr. 11(3):228-275, from p. 261 (1941).
  • Myers, P., R. Espinosa, C. S. Parr, T. Jones, G. S. Hammond, and T. A. Dewey. 2006. The Animal Diversity Web (online). Accessed February 16, 2011 at http://animaldiversity.org. http://www.animaldiversity.org
  • P. G. Howes, The Giant Cactus Forest and Its World: A Brief Biology of the Giant Cactus Forest of Our American Southwest (Duell, Sloan, and Pearce, New York; Little, Brown, Boston; 1954), from pp. 222-239, from p. 227.
  • R. D. Bird, Biotic communities of the Aspen Parkland of central Canada, Ecology, 11:356-442, from p. 383 (1930).
  • Waide RB, Reagan WB (eds) (1996) The food web of a tropical rainforest. University of Chicago Press, Chicago
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Breeding density (pairs /sq. km) varies from 0.03 (Utah) to 0.78 (California); mostly less than 0.025 (but 0.2-0.6 pairs/sq. km in different habitats in Puerto) (Santana 1988, Rothfels and Lein 1983). In Puerto Rico, remains paired and defends territory throughout the year (Santana 1988). Also territorial in winter in at least some parts of the U.S. In a largely sedentary population in Wisconsin, mean seasonal home ranges varied as follows: fall male 390 ha (n=1), female 123 ha (n=2); winter male 157 ha (n=3), female 167 ha (n=6); spring male 163 ha (n=2), female 85 ha (n=6); summer male 117 ha (n=1), female 117 ha (n=5) (Petersen 1979). Most forage within 3 kilometers of the nest (Kochert 1986). See Palmer (1988) for discussion of interactions with other hawks and Great Horned Owl.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat-related Fire Effects

More info for the terms: cover, fire suppression, fresh, natural, shrubs

Red-tailed hawks occur in the following 10 major fire-dependent plant
associations in the western United States:  grasslands, semidesert
shrub-grasslands, sagebrush (Artemisia spp.)-grasslands, chaparral,
pinyon-juniper (Pinus spp.-Juniperus spp.) woodland, ponderosa pine,
Douglas-fir, spruce-fir (Picea spp.-Abies spp.), redwood (Sequoia
sempervirens), and giant sequoia (Sequoiadendron giganteum) forests
[29].

Suppression of fires in large expanses of treeless areas may benefit
red-tailed hawks.  In southern Saskatchewan, the control of fires on the
once open prairies and the planting of trees and shrubs has resulted in
a semiopen, tree-grassland mosaic and consequent territory expansion and
population increase of red-tailed hawks [38].

Although fire may reduce potential nest trees, it may also create snags
for perch sites and enhance the foraging habitat of red-tailed hawks.
Red-tailed hawks often perch on snags created by lightning strikes [3].
They often use fresh burns when foraging due to increased prey
visibility [15,27,32,36].  Regular prescribed burning helps to maintain
habitat for many prey species of red-tailed hawks [10,15,27,29,32].
Several studies indicate that many prey populations increase rapidly
subsequent to burning in response to increased food availability
[15,27].  Fire suppression in grasslands was detrimental to small bird
and mammal populations due to organic matter accumulation and reduced
plant vigor [47].

The suppression of natural fire in chaparral has resulted in reduced
seral stage diversity and less edge [15] which has probably affected
red-tailed hawks in these communities.  Red-tailed hawks are more
abundant in recently burned chaparral areas than in unburned areas due
to greater visibility and less cover for prey [36].  Additionally,
red-tailed hawks are favored by fires that open up or clear
pinyon-juniper woodlands [32].  Raptors associated with pinyon-juniper
woodlands depend upon edges of openings created by fire and scattered
islands of unburned woodlands [15].

In the first year following a severe fire in grassland, ponderosa pine,
Douglas-fir, and mountain big sagebrush (Artemisia tridentata ssp.
vaseyana) habitat types on the Salmon National Forest, several
red-tailed hawks were observed within the burn.  They were not observed
in the area before the fire [10].  Following a fire in a mountain big
sagebrush community on the Bridger-Teton National Forest, red-tailed
hawks were more commonly observed using an area that experienced a
severe fall fire than in a nearby area burned by a low-severity spring
fire [33].  Red-tailed hawks have also been observed hunting on recently
burned areas in Colorado County, Texas [2].
 
Although fire is often beneficial to red-tailed hawk prey species, Yensen
and others [48] reported that in the Snake River Birds of Prey Area,
southwestern Idaho, fire may reduce populations of Townsend's ground
squirrels (Spermophilus townsendii).

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Timing of Major Life History Events

More info for the term: hibernation

Age at sexual maturity - Red-tailed hawks are generally sexually mature
at 2 years of age [38].

Breeding season - The breeding season generally occurs from late January
to September depending on geographic area [16,22,38,46].  Full clutches
may be expected as early as February in warmer parts of California and
in other states bordering Mexico and/or the Gulf coast.  For most of the
contiguous United States, clutches are laid in March.  In the northern
states and southern Canada, clutches are laid from March to early May.
In interior Alaska clutches are laid from April to late May [38].

Clutch size and incubation - Red-tailed hawks lay two to four eggs, with
three most common [16,22,38,46].  Clutch size may vary with prey
availability [38].  The eggs are incubated for 28 to 34 days [22,38].
If the first clutch is destroyed, red-tailed hawks may lay a replacement
clutch within 3 or 4 weeks [38].

Fledging - Nestlings fledge in 42 to 46 days [16,20,22,38].  Males
fledge earlier than females [38].  Fledglings continue to be fed by
parents and remain within the nesting territory for 30 days or more
after fledging [20].

Migration - Red-tailed hawks migrate as individuals.  Some established
breeders (especially in the southern United States) remain on or near
their territories all year.  Near Fairbanks, Alaska, a mature red-tailed
hawk spent three consecutive winters in the same territory [38].

Spring migration starts in February and March in northern Mexico and the
southern United States.  Early arrivals reach the northern states while
the ground is still under snow.  Along the Canadian border in the Great
Lakes region some red-tailed hawks are still migrating in late May and
June [38].  Western red-tailed hawks arrival in Yellowstone National
Park in the spring is probably dependent on the appearance of the ground
squirrels, which come out of hibernation about the first of April [52].

Fall migration from Canada and the adjoining northern states begins in
August and continues through early October.  Eastern red-tailed hawks
begin to migrate south from New England and other northern parts of
their range early in September [52].  Further south, red-tailed hawks
begin migrating from early October to mid-December [38].

Longevity - Red-tailed hawks have been reported to live up to 16 years
in the wild and 29 years in captivity [22].  The average longevity for a
red-tailed hawk that survives to maturity is 6 to 7 years [38].

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Adult red-tailed hawks make a call that sounds like "kee-eeee-arrr." It is often described as sounding like a steam whistle. Young red-tailed hawks communicate with their parents by making soft, low "peep"-ing sounds.

Red-tailed hawks also communicate through body language. In an aggressive posture, the body and head of a red-tailed hawk are held upright, and its feathers are standing up. In submission, the hawk's head is lower to the ground and the feathers are smooth. Red-tailed hawks also display many aerial behaviors. In the talon-drop, during courtship, they swoop down trying to touch one another with their talons. Undulating-flight is an up and down movement that is mainly used in territorial display. In the dive-display, the bird performs a steep dive. This display signals that his territory is occupied.

Red-tailed hawks have excellent vision. This allows them to see prey movements very far away.

Communication Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Adult red-tailed hawks make what is called a horse scream, "kee-eeee-arrr." It is often described as sounding like a steam whistle. The length and pitch of this call varies with the age, gender, and geographic region of the individual red-tailed hawk.

Young red-tailed hawks communicate with their parents by making soft, low "peep"-ing sounds. As they get older, they sounds they make deepen in tone, and are usually sounds of hunger.

Red-tailed hawks also communicate through body language. In an aggressive posture, the body and head of the  red-tailed hawk are held upright and its feathers are standing up. In submission, the hawk's head is lower to the ground and the feathers are smooth. Red-tailed hawks also display many aerial behaviors. In the talon-drop, during courtship, they swoop down trying to touch one another with their talons. Undulating-flight is an up and down movement that is mainly used in territorial display. Finally, in the dive-display the bird performs a steep dive. This is also a territorial display.

Red-tailed hawks have extraordinarily keen vision, which allows them to detect prey movements at great distances.

Communication Channels: visual ; acoustic

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cyclicity

Comments: Rain and fog reduce flying activity and foraging time in forest birds in Puerto Rico (Santana 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Red-tailed hawks are relatively long-lived birds. While many of these birds die young (most live less than two years), those that survive the first few years can live for many years. The oldest known wild red-tailed hawk lived to at least 21.5 years old. In captivity, red-tailed hawks have lived for at least 29.5 years.

Range lifespan

Status: wild:
29.5 (high) years.

Range lifespan

Status: captivity:
29.5 (high) years.

Average lifespan

Status: wild:
346 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan/Longevity

Red-tailed hawks are relatively long-lived birds. While many of these birds die young (most live less than two years), those that survive the first few years can live for many years. The oldest known wild red-tailed hawk lived to at least 21.5 years old. In captivity, red-tailed hawks have lived for at least 29.5 years.

Range lifespan

Status: wild:
29.5 (high) years.

Range lifespan

Status: captivity:
29.5 (high) years.

Average lifespan

Status: wild:
346 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 29.5 years (captivity) Observations: The average longevity for these animals once they reach maturity is about 6 to 7 years. In the wild they do not live more than 16 years (http://www.fs.fed.us/database/feis/).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Red-tailed hawks usually begin breeding when they are three years old. They are monogamous, and mate with the same individual for many years. In fact, red-tailed hawks usually only change mates when their original mate dies. During courtship, the male and female soar together in circles, with flights lasting 10 minutes or more. Mating usually takes place following these flights. The male and female land on a perch and preen each other. The female then tilts forward, allowing the male to mount her. Copulation lasts 5 to 10 seconds.

Mating System: monogamous

Red-tailed hawk nests are usually 28 to 38 inches in diameter. They are sometimes used for several years, and can be up to 3 feet tall. The male and female both construct the nest in a tall tree, 4 to 21 meters above the ground. Where trees are scarce, they are sometimes built on cliff ledges or artificial structures such as on buildings. The nests are constructed of twigs and lined with bark, pine needles, corn cobs, husks, stalks, aspen catkins and other soft plant matter. Fresh bark, twigs, and pine needles are deposited into the nest throughout the breeding season to keep the nest clean. Owls compete with the red-tailed hawks for nest sites. Each species is known to kill the young and destroy the eggs of the other in an attempt at taking a nest site.

The female lays 1 to 5 eggs around the first week of April. The eggs are laid approximately every other day and are incubated for 28 to 35 days. Both parents incubate the eggs. Males may spend less time incubating than females, but bring food to the female while she is on the nest. The young hatch over the course of 2 to 4 days, and are altricial at hatching. During the nestling stage, the female broods the young, and the male provides most of the food to the female and the chicks. The female feeds the nestlings by tearing the food into small pieces. The chicks begin to leave the nest after 42 to 46 days. The fledgling period lasts up to 10 weeks, during which the chicks learn to fly and hunt.

Breeding interval: Red-tailed hawks breed each spring.

Breeding season: Breeding occurs in the spring.

Range eggs per season: 1 to 5.

Range time to hatching: 28 to 35 days.

Average time to hatching: 30 days.

Range fledging age: 42 to 46 days.

Range time to independence: 10 (high) weeks.

Average age at sexual or reproductive maturity (female): 3 years.

Average age at sexual or reproductive maturity (male): 3 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization ; oviparous

Average eggs per season: 3.

Average age at sexual or reproductive maturity (male)

Sex: male:
730 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
730 days.

Both parents incubate the eggs. Males may spend less time incubating than females, but bring food to the female while she is on the nest. The newly hatched chicks are altricial (helpless). During the nestling stage, the female broods the young, and the male provides most of the food to the female and the chicks. The female feeds the nestlings by tearing the food into small pieces. The chicks begin to leave the nest after 42 to 46 days. After they leave the nest, young red-tailed hawks usually stay in one place, close to their parents. They begin to fly about 3 weeks after they first begin to leave the nest, and begin to catch their own food 6 to 7 weeks after that. They become completely independent from their parents by about 10 weeks after fledging, at about 112 to 116 days old.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female)

  • Preston, C., R. Beane. 1993. Red-tailed hawk (Buteo jamaicensis). Pp. 1-24 in A Poole, F Gill, eds. The Birds of North America, Vol. 52. Washington DC and Philadelphia, PA: The Academy of Natural Sciences and The American Ornithologists' Union.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Clutch size commonly is 2-3. Incubation lasts about 34 days per egg, mostly by female. Young are tended by both parents, may leave nest at about 4 weeks, fly at about 6.5-7 weeks, depend on parents for food for at least a few weeks after fledging. If clutch lost, renests usually in another nest a few weeks later. Successful reproduction usually does not occur before age 2 years. Pair bond typically lifelong, at least in nonmigratory populations and probably in migrants as well.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red-tailed hawks usually begin breeding when they are three years old. They are monogamous, and mate with the same individual for many years. In fact, red-tailed hawks usually only change mates when their original mate dies. During courtship, the male and female soar together in circles for up to 10 minutes before mating.

Mating System: monogamous

Red-tailed hawk nests are usually 28 to 38 inches wide. They are often used for several years in a row, and can be up to 3 feet tall. The male and female work together to build the nest in a tall tree, 4 to 21 meters above the ground. Where there are not trees to build nests in, red-tailed hawks build their nests on cliff ledges or on man-made structures such as buildings. The nests are made of twigs and lined with bark, pine needles, corn cobs, husks, stalks, aspen catkins and other soft plant materials. The hawks put fresh bark, twigs, and pine needles in the nest throughout the breeding season to keep it clean.

The female lays 1 to 5 eggs around the first week of April. The eggs are laid every other day and are incubated for 28 to 35 days. Both parents incubate the eggs. Males bring food to the female while she is on the nest. The newly-hatched chicks are helpless (altricial). During the nestling stage, the female broods the young, and the male provides most of the food to the female and the chicks. The female feeds the chicks by tearing the food into small pieces. The chicks begin to leave the nest after 42 to 46 days. They learn to fly and hunt, and leave the nest for good after 10 weeks or so.

Breeding interval: Red-tailed hawks breed each spring.

Breeding season: Breeding occurs in the spring.

Range eggs per season: 1 to 5.

Range time to hatching: 28 to 35 days.

Average time to hatching: 30 days.

Range fledging age: 42 to 46 days.

Range time to independence: 10 (high) weeks.

Average age at sexual or reproductive maturity (female): 3 years.

Average age at sexual or reproductive maturity (male): 3 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization

Average eggs per season: 3.

Average age at sexual or reproductive maturity (male)

Sex: male:
730 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
730 days.

Both parents incubate the eggs. When the chicks are nestlings, the female broods them to protect them from predators and hot and cold temperatures. The male provides most of the food to the female and the chicks, and the female feeds the nestlings by tearing the food into small pieces. The chicks begin to leave the nest after 42 to 46 days. After they leave the nest, young red-tailed hawks usually stay close to their parents. They begin to fly about 3 weeks after they first begin to leave the nest, and begin to catch their own food 6 to 7 weeks after that. They become completely independent from their parents by about 10 weeks after fledging, at about 112 to 116 days old.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female)

  • Preston, C., R. Beane. 1993. Red-tailed hawk (Buteo jamaicensis). Pp. 1-24 in A Poole, F Gill, eds. The Birds of North America, Vol. 52. Washington DC and Philadelphia, PA: The Academy of Natural Sciences and The American Ornithologists' Union.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Buteo jamaicensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATANCTAATCTTCGGCGCCTGGGCCGGTATAGTCGGCACCGCCCTCAGCCTACTTATTCGTGCAGAACTCGGCCAACCAGGCACACTTCTAGGCGACGACCAGATCTACAACGTAATCGTTACCGCACATGCCTTTGTAATAATTTTCTTCATGGTTATACCAATTATGATCGGAGGCTTCGGAAACTGACTTGTCCCACTCATAATCGGCGCCCCCGATATAGCCTTCCCACGCATAAACAACATAAGCTTCTGACTACTTCCTCCATCCTTCCTCCTCCTCCTAGCCTCCTCAACAGTAGAAGCAGGAGCCGGCACTGGATGAACTGTCTATCCCCCACTAGCTGGCAACATAGCCCATGCCGGAGCTTCAGTAGACCTAGCCATCTTCTCCCTACACCTAGCCGGAGTCTCGTCCATTCTAGGGGCAATCAACTTTATCACAACCGCCATCAACATAAAACCCCCAGCCCTCTCCCAATACCAAACACCCCTATTCGTATGATCTGTCCTCATTACCGCTGTCCTTCTACTACTCTCACTCCCAGTCCTAGCCGCTGGCATCACTATACTACTCACAGACCGAAACCTAAACACAACATTCTTTGACCCTGCTGGCGGAGGTGATCCCATCCTATACCAACATCTCTTTTGATTCTTCGGACACCCAGAAGTTTACATCCTAATCTTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Buteo jamaicensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5