Articles on this page are available in 1 other language: Spanish (22) (learn more)

Overview

Distribution

Harris' hawks can be found in semi-open habitats in the southwestern United States and northwestern Mexico, from Baja California to southern Arizona, New Mexico and Texas, extending south through Central and South America to Chile and just into Patagonia.

Biogeographic Regions: nearctic (Native ); neotropical (Native )

  • Johnsgard, P. 1990. Hawks, Eagles, and Falcons of North America. Washington and London: Smithsonian Institution Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: RESIDENT: southern Kansas and vicinity (casually or formerly), and from northern Baja California, southeastern California (formerly, recently reintroduced), southern Arizona, southern New Mexico, and central Texas south to central Chile and central Argentina. Breeding distribution tends to be spotty. In the U.S., most numerous in winter in western and southern Texas (Root 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

These are large hawks with long tails and broad wings. Harris's hawks range in length from 18 to 23 inches (46 to 76 cm) and have wingspans of 40 to 47 inches (100 to 120 cm). Adult plumage is uniformly chocolate brown with distinct reddish shoulders, upper and underwing coverts, and leg feathers. The tail is dark with white upper and undertail coverts and a white base and terminal band. Juveniles are similar to adults but are less distinctly colored and have a white belly with chocolate brown streaking. The tarsal feathers are pale with reddish barring and there is barring on the tail and wings. Females weigh an average of 1,047 grams, and males are smaller, weighing an average of 735 grams.

Range mass: 735 to 1047 g.

Range length: 46 to 76 cm.

Range wingspan: 100 to 120 cm.

Sexual Dimorphism: female larger

Other Physical Features: endothermic ; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 53 cm

Weight: 1047 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Harris' hawks are found in various habitats, from upland desert dominated by saguaros to mesquite, palo verde, and ironwood woodlands in the Colorado River valley. There is a population of hawks being reintroduced to the Colorado River that prefer to nest near water in mequite, willows and cottonwoods. In urban areas, they are seen utilizing washes, open lots, and open desert. These hawks may be found at elevations of 400 to 1,000 meters.

Range elevation: 400 to 1,000 m.

Habitat Regions: temperate ; tropical

Terrestrial Biomes: desert or dune ; savanna or grassland ; scrub forest

Other Habitat Features: urban ; suburban ; riparian

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Mainly savanna, open woodland, and semidesert, especially vicinity of marshes, swamps, and large bodies of water (AOU 1983); also near small water sources such as man-made cattle-watering ponds and catchments. River woodland, mesquite forest, saguaro-paloverde desert, brushy flatlands (Harrison 1979). Also suburban areas in southern Arizona. Additional habitats south of Mexico. Water appears to be an important resource in the Sonoran Desert.

Nests in tree, tall shrubby growth, on cactus, power line tower; often low, 1.5-9 m above ground. In Arizona, used saguaro cactus and enclosed tree sites (Mader 1978). Sometimes builds supernumerary nests. Commonly nests in same nest or nest site in successive years.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Seasonal migration has not been observed in Arizona or New Mexico (Bednarz et al. 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

The diet of Harris' hawks is versatile and varies with prey availability. These hawks feed mostly on small mammals such as rats and mice, but also take birds and lizards. They commonly hunt in groups of about five hawks, increasing their success rate and enabling them to take larger prey such as cottontails and jack rabbits. These hunting groups consist of a breeding pair and other helpers, with the female dominating. They are fast flyers and once they have spotted their prey, they land and take turns trying to scare and actually flush the prey animal until it darts from beneath its hiding place. Another member of the hunting group captures the animal and assumes a posture known as mantling, in which the hawk shields the prey with its wings to hide it from other birds. It has been suggested that group hunting is encouraged by the dense brush and thorny nature of their habitat. There is some evidence that these hawks may feed on carrion if food availability is low.

Animal Foods: birds; mammals; reptiles

Primary Diet: carnivore (Eats terrestrial vertebrates)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Diet includes mainly small mammals up to rabbit size, various birds, small reptiles, occasionally insects (Terres 1980, Palmer 1988, Bednarz 1988). Cooperative hunting well developed (pairs or groups of commonly 3-7).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Harris' hawks are important predators in their ecosystem, controlling populations of many small mammal species.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Great horned owls (Bubo virginianus) pose the greatest predation threat to this species, but coyotes (Canis latrans) and common ravens (Corvus corax) also threaten young hawks. Female Harris' hawks utilize helpers to protect their nests. The helpers perch in saguaros and scan the surroundings for predators. They tend to become excited and will use an alarm call when predators come within their nesting area. Groups consisting of 2 to 5 hawks will attack and harass any predator threatening the nest. The alpha male is most likely to strike the predator as the female stays behind to protect the nest. This establishment of helpers greatly increases the detection of predators and nest success.

Known Predators:

  • great horned owls (Bubo virginianus)
  • coyotes (Canis latrans)
  • common ravens (Corvus corax)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Parabuteo unicinctus is prey of:
Bubo virginianus
Corvus corax
Canis latrans

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

In southern Arizona, 2.5-5 sq km per active nest in saguaro-paloverde (see Palmer 1988, Bednarz et al. 1988). In Pinal County, Arizona, average of one nest per 2.0 sq km; hawks in breeding groups rarely ranged beyond 0.8 km from active nests, except to visit water sources; resident hawks chased trespassing conspecifics out of the nest area during breeding and nonbreeding periods (Dawson and Mannan 1991). Reportedly not territorial in New Mexico, though this may be questionable (see Dawson and Mannan 1991). In Texas, breeding distribution may shift in relation to rainfall pattern and prey abundance (see Palmer 1988). In fall and winter, often in large social aggregations (about 4-11 individuals) that form in zones between nesting areas (Dawson and Mannan 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Like all hawks, Harris' hawks have keen vision and hearing. They are known to make hissing noises, give alarm calls, and probably communicate visually as well.

Communication Channels: visual ; acoustic

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cyclicity

Comments: In Costa Rica, hunts mostly early and late in day (Stiles and Skutch 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Records on longevity are collected from the Bird Banding Laboratory (BBL) in Laurel, Maryland. The maximum longevity record for Harris' hawks is 14 years, 11 months.

Range lifespan

Status: wild:
14.9 (high) years.

Average lifespan

Status: wild:
179 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 25 years (captivity)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Most often, social groups of Harris' hawks contain a single monogamous breeding pair. However, these hawks are known to practice simultaneous polyandry, where more than one male mates with one female and shares in the responsibilities of raising offspring. Polyandry is commonly found in areas where the habitat quality is rich as opposed to arid habitats where the chances of reproductive success are less, even when there are three adults hunting. It is also found to be common in Arizona where the sex ratio is significantly skewed towards males, in comparison with areas such as Texas, where the sex ratio is not as skewed.

Mating System: monogamous ; polyandrous ; cooperative breeder

Harris' hawks build their nests in saguaros, palo verdes and mesquite trees at an average height of 5 meters. In urban areas, nests can be found on cottonwoods, ironwoods, palm trees and electrical towers. Nests are platforms made of sticks, weeds, twigs, and are usually lined with soft mosses, grasses and roots. Between two and four eggs are laid at a time. Females have the ability to breed all year long and can lay two to three clutches within a year. The incubation period lasts about 35 days and the males often share duties with the female during this period. Fledging occurs after another 40 days. The young birds tend to stay around the nest area for two to three months longer.

Breeding interval: Harris' hawks breed two to three times per year.

Breeding season: Harris' hawks breed year round.

Range eggs per season: 3 to 15.

Average eggs per season: 6.

Range time to hatching: 33 to 37 days.

Range fledging age: 35 to 45 days.

Average time to independence: 2-3 months.

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization ; oviparous

Average eggs per season: 3.

Both the female and the male contribute to parental care. Harris' hawks practice cooperative breeding, with several birds helping with building nests, incubation, feeding, and defense. This assistance increases nest success. There is often a trio consisting of two males and a female which aid in the nest cycle.

Parental Investment: pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Male, Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Long breeding season (February to early December [egg laying to fledging of young in second broods] in southern Arizona). Clutch size commonly 2-3. Sometimes 2 broods/year. Incubation 33-36 days, by both sexes. Young tended by both parents, fledge at about 6 weeks, may remain with parents for several months after fledging. Some yearlings breed. Cooperative breeder; one or more helpers, which may or may not be related to the breeders, often are active in procuring prey, transporting prey to the nest area, and defending the nest from predation by great horned owls (Dawson and Mannan 1991); sometimes female pairs with two males, with both males incubating the eggs and feeding and brooding the young. See Dawson and Mannan (1991) for detailed information on mating relationships and helper contributions in Arizona. See Bednarz (1988) for information on reproduction in New Mexico. In southern Arizona, nest success was about 68%; 50 nests fledged an average of 1.6 young (Mader 1978).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Parabuteo unicinctus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNCCTATACCTAATCTTCGGCGCCTGAGCTGGTATAGTCGGCACCGCCCTCAGCTTACTCATCCGTGCAGAACTCGGCCAACCCGGCACACTCCTAGGTGACGACCAAATTTATAACGTAATCGTTACCGCACATGCCTTCGTAATAATCTTCTTCATAGTTATACCAATCATGATCGGAGGATTCGGAAACTGACTTGTTCCACTCATAATTGGCGCTCCCGACATAGCCTTTCCACGCATAAACAACATAAGCTTCTGACTACTCCCCCCATCCTTCCTCCTCCTACTAGCTTCCTCAACAGTAGAAGCAGGAGCCGGTACTGGATGAACTGTCTATCCTCCCTTAGCTGGCAACATAGCCCATGCCGGAGCTTCAGTAGACCTAGCCATCTTCTCTCTACACTTAGCCGGAGTTTCATCCATTCTAGGGGCGATCAACTTCATCACAACCGCCATTAATATAAAACCCCCAGCACTCTCCCAGTACCAAACACCCCTGTTTGTATGATCTGTACTCATCACTGCCGTCCTTCTACTACTCTCACTCCCAGTCCTAGCCGCTGGCATCACTATACTACTTACAGACCGAAACCTAAACACAACATTCTTTGACCCTGCCGGCGGAGGCGATCCCATCCTCTACCAACATCTCTTCTGATTCTTCGGACACCCAGAAGTCTACATCTTAATCCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Parabuteo unicinctus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5