Articles on this page are available in 1 other language: Spanish (11) (learn more)

Overview

Brief Summary

Biology

Golden eagles hunt in a range of ways; they may soar and search for prey from on high, or sit in a tree on the look-out. They have also been seen flying low and then ambushing their prey. Food items taken include a range of small mammals including hares, rabbits, young foxes and rodents, as well as gamebirds and carrion (2).  Pairs mate for life, and the huge nest (or 'eyrie') built in a tree or on a cliff-ledge will be used year after year providing it is not disturbed (2). Furthermore, these nests may be used by successive generations (6). Display flights occur during courtship in which the pair performs plunging and looping flights (6). Two eggs are laid following mating, and these are incubated for up to 45 days. The chicks fledge after 65-70 days. Golden eagles may live for as long as 32 years (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Aquila chrysaetos

An extremely large (30-40 inches) raptor, the Golden Eagle is much larger than the largest North American hawk and is only marginally smaller than the Bald Eagle (Haliaeetus leucocephalus). With its dark brown body, dull yellow legs, and yellow bill, the Golden Eagle may be difficult to separate at a distance from an immature Bald Eagle, which has these same field marks and lacks the white head and tail of adults. With a good view, however, it is possible to identify a Golden Eagle by looking for a golden wash to the back of its neck. Male and female Golden Eagles are similar to one another in all seasons, although females are slightly larger. The Golden Eagle may be found across the northern hemisphere. In North America, this species breeds primarily in the mountain west from Alaska to central Mexico. In winter, Golden Eagles breeding in Canada and Alaska move south, while those in the Rocky Mountains move to lower altitudes. Golden Eagles were formerly more numerous in eastern North America, but have retracted their range westward in response to increasing pressure from humans. Small numbers of Golden Eagles breed in eastern Canada and winter locally in the northeastern U.S. and Mid-Atlantic region. In Eurasia, the Golden Eagle inhabits much of northern Eurasia, with isolated populations further south, especially at higher latitudes in southern Europe, Asia Minor, and the Himalayas. In summer, the Golden Eagle breeds in a variety of habitats, including tundra, grasslands, and coniferous forests. Winter habitats are similar to breeding habitats, but may also include wetlands. Golden Eagles primarily hunt small mammals, including rabbits, hares, and squirrels, and marmots, but may scavenge carrion when available. Golden Eagles may be most easily observed soaring on long, broad wings held flat (as opposed to vultures, which soar with their wings in a “v” shape). Individuals may also be observed perching in trees or other prominent locations, and adults may be seen entering nests to feed chicks. Golden Eagles are primarily active during the day.

Threat Status: Least Concern

  • Aquila chrysaetos. Xeno-canto. Xeno-canto Foundation, n.d. Web. 20 July 2012. .
  • Golden Eagle (Aquila chrysaetos). The Internet Bird Collection. Lynx Edicions, n.d. Web. 20 July 2012. .
  • Kochert, M. N., K. Steenhof, C. L. Mcintyre and E. H. Craig. 2002. Golden Eagle (Aquila chrysaetos), The Birds of North America Online (A. Poole, Ed.). Ithaca: Cornell Lab of Ornithology; Retrieved from the Birds of North America Online: http://bna.birds.cornell.edu/bna/species/684
  • Peterson, Roger Tory. Birds of Eastern and Central North America. Boston: Houghton Mifflin, 1980. Print.
  • eBird Range Map - Golden Eagle. eBird. Cornell Lab of Ornithology, N.d. Web. 20 July 2012. .
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Institution

Supplier: DC Birds

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

Although the majestic golden eagle is not Britain's largest raptor (the white-tailed eagle exceeds it in size) nor is it the rarest, it has a certain powerful resonance in the British psyche as an enduring symbol of strength and wildness (4) (5). This huge bird of prey can be identified by its very long wings and long tail. When gliding or soaring it typically holds its wings in a shallow 'V' (2). The plumage is dark brown rather than golden and the massive talons are bright yellow. The feathers of the head and nape of the neck are typically light yellowish or reddish-brown, giving the appearance of a 'shawl'. Males and females are similar in appearance, but juveniles can be distinguished by the presence of white patches on the undersides of the wings and on both surfaces of the tail (2). This raptor rarely makes sound, although a thin whistle is occasionally produced in flight (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Longueur 75-88 cm, envergure 2,05-2,20 m, poids moyen 2,8-4,6 kg pour le mâle, 3,8-6,7 kg pour la femelle.

Il vit dans les grands espaces ouverts, parfois les zones humides mais le plus souvent les zones montagneuses, loin des activités humaines. L’absence de spécialisation alimentaire (et de forte compétition interspécifique) et sa capacité à chasser sur de grandes distances lui permettent de survivre même avec une densité et une biomasse de proies relativement faibles.

L’Aigle royal se nourrit principalement de mammifères et d’oiseaux vivants ou morts, parfois aussi de reptiles et même de poissons et d’insectes. Il chasse habituellement d’un vol bas, parcourant méthodiquement le terrain et capturant ses proies par surprise. La plupart sont prises au sol mais un oiseau dérangé, un Lagopède par exemple, peut être poursuivi sur quelque distance. L’éventail de proies est très large : les mammifères vont du petit rongeur jusqu’aux Cervidés, tandis que les oiseaux vont de l’Alouette jusqu’à l’Oie ou la Grue. Ses préférences vont toutefois vers les animaux pesant entre 0,5 et 2 kg. Les proies les plus grosses ne sont consommées qu’à l’état de cadavre ou si elles sont affaiblies, et sont notamment attaquées par des individus spécialisés ou inexpérimentés. Il arrive que le couple chasse de concert, le premier oiseau pouvant ainsi disperser les groupes familiaux d’Ongulés et le second, suivant à une centaine de mètres, se concentrant alors sur un jeune isolé.

Les jeunes aigles se dispersent parfois sur de grandes distances, mais les adultes restent sur leur territoire. Même en hiver, ils gardent le contact avec leur site de nid, à moins que la famine ou les conditions météorologiques ne les forcent à s’éloigner. Les oiseaux solitaires, jeunes ou adultes, sont généralement erratiques mais certains s’établissent sur un territoire, parfois même inclus dans celui d’un couple nicheur. L’Aigle royal est monogame et les couples sont fidèles. Ils sont territoriaux et les aires des différents couples sont largement séparées (au moins 4 km et en général 10 à 20 km). Les parades aériennes sont peu fréquentes ; elles comprennent des plongées vertigineuses depuis de grandes hauteurs, suivies de remontées en chandelle.

La ponte de 1 à 3 œufs est déposée à partir de février-mars. L’aire est construite sur une paroi rocheuse ou un arbre. C’est un énorme assemblage de branchettes, couvert d’herbes, de laine et de feuillage. Les plus gros atteignent plusieurs mètres d’épaisseur. L’incubation dure 43-45 jours et les jeunes s’envolent à l’âge de 65-80 jours. En général, seul le 1er aiglon éclos survit, car il cause la mort des autres jeunes, plus petits. Il est chassé par ses parents entre septembre et novembre.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Muséum national d'Histoire naturelle. Service du Patrimoine naturel

Source: Inventaire National du Patrimoine Naturel

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Golden eagles (Aquila chrysaetos) have a Holarctic distribution. They occur throughout Eurasia, in northern Africa, and in North America. In North America, golden eagles are found in the western half of the continent, from Alaska to central Mexico, with small numbers in eastern Canada and scattered pairs in the eastern United States.

Biogeographic Regions: nearctic (Native ); palearctic (Native ); ethiopian (Native )

Other Geographic Terms: holarctic

  • Kochert, M., K. Steenhof, C. McIntyre, E. Craig. 2002. Golden Eagle (Aquila chrysaetos). Pp. 1-44 in A Poole, F Gill, eds. The Birds of North America, Vol. 684. Philadelphia: The Birds of North America.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) In North America, breeding occurs from western and northern Alaska eastward through Northwest Territories to Labrador, and south to northern Mexico, Texas, western Oklahoma, and western Kansas, and in eastern North America southward to New York and northern New England (rare). See Lee and Spofford (1990) for a review of nesting records from the central and southern Appalachians (most nesting records south of the Adirondacks are doubtful). Golden eagles breed also in the Palearctic. The winter range in North America extends from south-central Alaska and southern Canada southward through the breeding range, and casually farther southward. In the United States, the species is most numerous in winter in the Rocky Mountain states, Great Basin, and western edge of the Great Plains (Root 1988). See Milsap and Vana (1984) for information on winter range in the eastern United States. Northernmost populations in Eurasia winter south to northern Africa (Sibley and Monroe 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Golden eagles (Aquila_chrysaetos) have a Holarctic distribution. They occur throughout Eurasia, in northern Africa, and in North America. In North America, golden eagles are found in the western half of the continent, from Alaska to central Mexico, with small numbers in eastern Canada and scattered pairs in the eastern United States.

Biogeographic Regions: nearctic (Native ); palearctic (Native ); ethiopian (Native )

Other Geographic Terms: holarctic

  • Kochert, M., K. Steenhof, C. McIntyre, E. Craig. 2002. Golden Eagle (Aquila chrysaetos). Pp. 1-44 in A Poole, F Gill, eds. The Birds of North America, Vol. 684. Philadelphia: The Birds of North America.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

In North America the golden eagle breeds from northern and western
Alaska east to Labrador and south to southern Alaska, Baja California,
western and central Texas, western Oklahoma, western Kansas, and the
highlands of northern Mexico (south to Durango, Guanauato, and Nuevo
Leon) [1,8]. A remnant eastern population of golden eagles extends from
Quebec into the Appalachian Mountains [9]. The golden eagle has never
been common in the eastern United States. Fewer than 30 historical
breeding territories are documented in the Northeast, primarily in New
York, New Hampshire, and Maine [26].

The golden eagle winters from south-central Alaska and the southern
portions of the Canadian provinces south throughout the breeding range
to Mexico, rarely to coastal South Carolina [8,9].

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Regional Distribution in the Western United States

More info on this topic.

This species can be found in the following regions of the western United States (according to the Bureau of Land Management classification of Physiographic Regions of the western United States):

1 Northern Pacific Border
2 Cascade Mountains
3 Southern Pacific Border
4 Sierra Mountains
5 Columbia Plateau
6 Upper Basin and Range
7 Lower Basin and Range
8 Northern Rocky Mountains
9 Middle Rocky Mountains
10 Wyoming Basin
11 Southern Rocky Mountains
12 Colorado Plateau
13 Rocky Mountain Piedmont
14 Great Plains
15 Black Hills Uplift
16 Upper Missouri Basin and Broken Lands

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Occurrence in North America

AL AK AZ AR CA CO CT DE FL GA ID IL IN IA KS KY LA ME MD MA MI MN MS MO MT NE NV NH NJ NM NY NC ND OH OK OR PA RI SC SD TN TX UT VT VA WA WV WI WY AB BC MB NB NF NT NS ON PE PQ SK YT MEXICO

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

This eagle has probably never been particularly common in Britain, as pairs require enormous territories (5). The British population is thought to number around 400 pairs at present (3). Most of these pairs are found in the Scottish Highlands, although more recently a few birds have returned to the Lake District, Cumbria (6). The species is extinct in Ireland, following persecution (3). The golden eagle's world range spreads through the Palaearctic region including mountainous parts of Europe as far south as northern Africa and south-east Asia. It also occurs in North America (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 1 person

Average rating: 2.0 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 1 person

Average rating: 1.0 of 5

Physical Description

Morphology

Golden eagles are North America's largest predatory bird. They are dark brown raptors with long, broad wings. Their length ranges from 70 to 84 cm, and their wingspan ranges from 185 to 220 cm. Males and females are similar in appearance, but females are much larger than males. Female weight ranges from 3940 to 6125 g whereas male weight ranges from 3000 to 4475 g. Adults are largely dark brown, except for a golden area near the crown, nape and sides of the neck and face. The tail is grayish brown. From below, the large flight feathers of the wings appear to be brownish gray, while the head, body and smaller feathers on the forepart of the open wings are blackish. The eyes of adults are dark brown. The bills and claws are black, while the cere and feet are yellow. The legs are feathered all the way down to the toes.

Juvenile golden eagles appear similar to adults, except for light patches on the tips of the wings, and a wide white band on the tail and a terminal band of black. This plumage is sometimes referred to as its "ringtail" plumage as a result of these bands. Juveniles attain adult plumage between ages 4 and 6 years.

There are 5 or 6 recognized subspecies of the golden eagle. These subspecies are differentiated by geographic distribution, size and coloration. Only one subspecies, Aquila chrysaetos canadensis is found in North America.

Range mass: 3000 to 6125 g.

Range length: 70 to 84 cm.

Range wingspan: 185 to 220 cm.

Other Physical Features: endothermic ; bilateral symmetry ; polymorphic

Sexual Dimorphism: female larger

Average basal metabolic rate: 4.9929 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Golden eagles are North America's largest predatory bird. They are dark brown raptors with long, broad wings. Their length ranges from 70 to 84 cm, and their wingspan ranges from 185 to 220 cm. Males and females look similar, but females are much larger than males. Females weigh from 3940 to 6125 g. Males weigh from 3000 to 4475 g. Adults are mostly dark brown. They have a grayish brown tail and golden brown on their heads. Adults have dark brown eyes. Their bills and claws are black and their ceres and feet are yellow. Their legs are covered in feathers all the way down to the toes.

Juvenile golden eagles look similar to adults, but they have light patches on the tips of their wings, and a wide white band on their tails. They begin to look like adults when they are 4 to 6 years old.

There are 5 or 6 subspecies of the golden eagle. Only one subspecies, Aquila chrysaetos canadensis is found in North America.

Range mass: 3000 to 6125 g.

Range length: 70 to 84 cm.

Range wingspan: 185 to 220 cm.

Other Physical Features: endothermic ; bilateral symmetry ; polymorphic

Sexual Dimorphism: female larger

Average basal metabolic rate: 4.9929 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 102 cm

Weight: 4692 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

This species differs from the bald eagle in lacking a white head in adults and in lacking white spotting on the underwing coverts in immatures.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat: Ecosystem

More info on this topic.

This species is known to occur in the following ecosystem types (as named by the U.S. Forest Service in their Forest and Range Ecosystem [FRES] Type classification):

FRES10 White-red-jack pine
FRES11 Spruce-fir
FRES12 Longleaf-slash pine
FRES13 Loblolly-shortleaf pine
FRES14 Oak-pine
FRES15 Oak-hickory
FRES16 Oak-gum-cypress
FRES17 Elm-ash-cottonwood
FRES18 Maple-beech-birch
FRES19 Aspen-birch
FRES20 Douglas-fir
FRES21 Ponderosa pine
FRES22 Western white pine
FRES23 Fir-spruce
FRES24 Hemlock-Sitka spruce
FRES25 Larch
FRES26 Lodgepole pine
FRES27 Redwood
FRES28 Western hardwoods
FRES29 Sagebrush
FRES30 Desert shrub
FRES31 Shinnery
FRES32 Texas savanna
FRES33 Southwestern shrubsteppe
FRES34 Chaparral-mountain shrub
FRES35 Pinyon-juniper
FRES36 Mountain grasslands
FRES37 Mountain meadows
FRES38 Plains grasslands
FRES39 Prairie
FRES40 Desert grasslands
FRES41 Wet grasslands
FRES42 Annual grasslands
FRES44 Alpine

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Habitat and Ecology

Habitat and Ecology

Behaviour This is the most widespread of the Aquila eagles, ranging across the Nearctic and Palearctic (70N to 20S), and fringing Indomalaya and the Afrotropics. It is uncommon to scarce across its range. In general, the species is sedentary, with juveniles dispersing as far as 1000km in their first few years. Birds occupying the mostly northerly regions (>65N), such as Alaska, northern Canada, Fennoscandia and northern Russia, migrate south. In the Nearctic there are southwards movements to southern Alaska and southwest USA in September, via regular flyways, in particular through southwest Alberta. In the Palearctic, movements occur in a broad front to wintering areas in southeast Europe, the Russian steppes, Mongolia, northern China and Japan. Juveniles and immatures will go as far as North Africa (Ferguson- Lees and Christie, 2001). Habitat The species occupies a wide range of flat or mountainous, largely open habitats, often above the tree line, from sea level to 4000m. In the Himalayas it has been recorded as high as 6200m (Watson, 2010). Diet The species diet is very broad, taking mammals, birds, reptiles, fish, amphibians, insects and carrion variously, depending on the regional prey availability. Prey taken are usually 0.5-4.0 kg and the species can hunt in pairs or small groups (Ferguson- Lees and Christie, 2001). Breeding Site Nesting occurs on cliff ledges and where these are not available, in large trees or similar artificial structures. Nests are constructed from sticks and are added to in successive years, growing to 2m in diameter. The breeding season spans March August throughout the majority of its range, and in southern areas begins as early as November; whilst in the most northerly regions it will start as late as April (Ferguson- Lees and Christie, 2001).


Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Golden eagles are found in open and semi-open habitats from sea level to 3600 m elevation. Habitat types that they inhabit include tundra, shrublands, grasslands, woodland-brushlands, and coniferous forests. Most golden eagles are found in mountainous areas, but they also nest in wetland, riparian and estuarine habitats.

Range elevation: 0 to 3600 m.

Habitat Regions: temperate ; polar ; terrestrial

Terrestrial Biomes: tundra ; taiga ; savanna or grassland ; chaparral ; forest ; mountains

Wetlands: marsh

Other Habitat Features: suburban ; agricultural ; riparian ; estuarine

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat Type: Terrestrial

Comments: Golden eagles generally inhabit open and semi-open country such as prairies, sagebrush, arctic and alpine tundra, savannah or sparse woodland, and barren areas, especially in hilly or mountainous regions, in areas with sufficient mammalian prey base and near suitable nesting sites. In Nevada, the only habitats routinely avoided by golden eagles are forests, large agricultural areas, and urban areas (GBBO 2010).

Nests are most often on rock ledges of cliffs but sometimes in large trees (e.g., oak or eucalytus in California, white pine in eastern North America), on steep hillsides, or on the ground. Nesting cliffs may face any direction and may be close to or distant from water. In Elko County, Nevada, 93 percent of nests were on cliffs, 71 percent were at elevations between 5,000 feet and 6,500 feet, and 43 percent faced east; 84 percent of nests were within two miles of water with desert riparian habitat (Page and Seibert 1973).

A pair may have multiple alternate nests; the pair may use the same or alternate nests in consecutive years.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Golden eagles live in open and semi-open habitats from sea level to 3600 m elevation. They can be found in habitats such as tundra, shrublands, grasslands, woodland-brushlands, and coniferous forests. Most golden eagles are found in mountainous areas, but they also nest in wetland, riparian and estuarine habitats.

Range elevation: 0 to 3600 m.

Habitat Regions: temperate ; polar ; terrestrial

Terrestrial Biomes: tundra ; taiga ; savanna or grassland ; chaparral ; forest ; mountains

Wetlands: marsh

Other Habitat Features: suburban ; agricultural ; riparian ; estuarine

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cover Requirements

More info for the terms: cover, shrub, tree

Golden eagles use elevated nest sites, especially sheltered ledges on
secluded cliffs, that are isolated from human disturbance and are close
to hunting areas [8,24]. Golden eagles are most efficient predators in
open areas where winds and thermal updrafts aid flying. They are less
efficient where shrub and/or tree cover increases. Abundant shrub cover
provides hiding and escape cover for prey. Physical obstructions close
to the ground make hunting difficult [18].

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Preferred Habitat

More info for the term: tundra

The golden eagle inhabits open country from barren areas to open
coniferous forests. They are primarily in hilly and mountainous
regions, but also in rugged deserts, on the plains, and in tundra. The
golden eagle prefers cliffs and large trees with large horizontal
branches and for roosting and perching [8].

Nesting habitat - The golden eagle nests on cliff ledges, preferably
overlooking grasslands; 10 to 100 feet (3-30 m) above ground in dead or
live trees; in artifical structures; or on the ground [8,7,27]. In
western mountains, golden eagles nest at elevations of 4,000 to 10,000
feet (1,219-3,048 m). Pairs may use the same nest year after year or
use alternate nests in successive years [8].

Golden eagles are most likely to use trees for nesting if cliff sites
are unavailable. In the Powder River Basin of Wyoming, 67 percent of
golden eagle nests were found in deciduous trees; 22 percent in
ponderosa pine (Pinus ponderosa); and 4 percent on the ground [19].
Near Medicine Bow, Wyoming, 60 percent of golden eagle nests were on
cliffs [17]. In Campbell and Converse counties, Wyoming, 57 percent of
occupied nests were found in deciduous trees along drainages and 25
percent were in ponderosa pine trees. The remaining nests were on rock
outcrops and peaks (8%), artifical structures (7%), and creekbanks (3%).
In Campbell and Converse counties golden eagles preferred to nest in
large pines when both cottonwoods and pines were available. Large dense
stands of both cottonwoods and pines were avoided as nest areas.
Isolated or scattered trees were preferred [22]. In the Coast Ranges
of California, the golden eagle nests almost exclusively in trees [21].

Foraging habitat - The golden eagle generally forages in open habitats
where rabbits and small rodents are available. During the nesting
season the golden eagle usually forages within 4.4 miles (7 km) of the
nest [7]. Trees, live or dead, are often used for perches if they are
near open areas where prey can be easily seen [30].

Winter habitat - Winter habitat requirements for the golden eagle are
very similar to nesting habitat requirements. In the East the golden
eagle generally winters on coastal plains and wetlands [7].

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associated Plant Communities

The golden eagle occupies a variety of plant communities including
tundra, alpine meadows, coniferous forests, shortgrass prairies and
other grasslands, sagebrush (Artemisia spp.) plateaus, sagebrush steppe
with scattered ponderosa pine (Pinus ponderosa) and cottonwoods (Populus
spp.), shrublands, oak (Quercus spp.) woodlands, pinyon-juniper (Pinus
spp.-Juniperus spp.) woodlands, and semidesert canyons [6,7,21,27,28].
In California the golden eagle favors grasslands, shrublands with tree
saplings, and open-canopy blue oak (Quercus douglasii) woodlands. In
late summer the golden eagle is often seen above timberline in
California [27]. Major vegetation types occupied by the golden eagle
during the nesting season in the Snake River Birds of Prey Area, Idaho,
from 1977 through 1979 include big sagebrush (Artemisia tridentata),
grassland (Poa and Bromus spp.), and shadscale (Atriplex confertifolia) [6].

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Cover Types

More info on this topic.

This species is known to occur in association with the following cover types (as classified by the Society of American Foresters):

More info for the term: cover

occurs in most SAF cover types

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Plant Associations

More info on this topic.

This species is known to occur in association with the following plant community types (as classified by Küchler 1964):

occurs in most Kuchler Plant Associations

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Breeds in mountainous areas and upland forests (2). In the UK it occurs mainly in uplands, but a handful of pairs are found in coastal habitats (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Migratory populations may exist in areas where the species is present throughout the year, so specific migration patterns may be obscure. Northernmost populations withdraw southward for winter (some individuals may remain in north); these migrants may migrate farther south than do birds from breeding populations to the south; migrants return to northern breeding areas mainly in March-April. Most vacate hot deserts during summer.

In predatory bird surveys over 12 months in the eastern Mohave Desert, San Bernardino County, California, Knight et al. (1999) observed golden eagles only during November and December, despite the species being a regular nesting bird in the Mohave Desert. The low number of observations may have reflected a naturally low density of eagles, lack of overlap of survey routes with eagle territories, or seasonal migrations of eagles between summer nesting areas in desert mountains and wintering areas in desert basins (Knight et al. 1999). See Palmer (1988) for discussion of seasonal movements.

A juvenile from Denali National Park, Alaska, migrated through Yukon Territory and interior British Columbia to a wintering site in east-central Idaho; another juvenile migrated through the Yukon, Alberta, and Saskatchewan to northeastern Montana (Britten et al. 1995).

Territory size in several areas of the western United States averaged 57-142 sq km (Palmer 1988). In desert regions, territories may be much larger (e.g., 258-310 sq km; see Wildlife Research Institute 2010).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

The diet of golden eagles is composed primarily of small mammals such as rabbits, hares, ground squirrels, prairie dogs, and marmots. They also eat birds, reptiles and fish in smaller numbers. Golden eagles occasionally capture large prey, including seals (Phocoidea), ungulates, coyotes and badgers. They have also been known to capture large flying birds such as geese or cranes. A pair of eagles will often hunt together; one chases the prey to exhaustion, and the other swoops down for the kill. Golden eagles rarely cache prey for later consumption.

Animal Foods: birds; mammals; reptiles; fish

Primary Diet: carnivore (Eats terrestrial vertebrates)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: The diet consists promarily of small mammals (e.g., rabbits, marmots, ground squirrels) but sometimes also includes large insects, snakes, birds, juvenile ungulates, and carrion. In the western Great Basin, the four most frequent prey species were black-tailed jackrabbit, mountain cottontail, yellow-bellied marmot, and chukar; Lagomorpha accounted for 91 percent of the prey biomass (Bloom and Hawks 1982). Golden eagles rarely attack large, healthy mammals (e.g., pigs, sheep, deer) (Terres 1980). Individual can fast for days between feedings. They hunt while soaring or from a perch (the latter especially used by young), and individuals may hunt cooperatively. See Palmer (1988) for further details.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Golden eagles mostly eat small mammals such as Leporidae, Sciuridae. They also eat some birds, reptiles and fish. Sometimes, golden eagles capture large prey, including seals (Phocoidea), ungulates, Canis latrans and Taxidea taxus. They have also been known to capture large flying birds such as geese or Gruidae.

A pair of eagles will often hunt together. One chases the prey until it is exhausted, then the other swoops down to kill it. Golden eagles don’t usually store prey to eat later.

Animal Foods: birds; mammals; reptiles; fish

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

The golden eagle feeds primarily on mammals. It feeds mainly on
lagomorphs and small rodents, but also on marmots (Marmota spp.),
prairie dogs (Cynomys spp.), ground squirrels (Spermophilus spp.),
weasels (Mustela spp.), woodrats (Neotoma spp.), skunks, mice, and
rarely, large mammals. The golden eagle also eats grouse, pheasants
(Phasianus spp.), owls, hawks, rock dove (Columba livia), magpies (Pica
spp.), and other birds as well as rattlesnakes, frogs, carrion, and
occasionally, fish [4,8,9,21,27].

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Golden eagles impact the local populations of the animals that they prey on. They may also compete with other species for prey and habitat. For example, golden eagles may compete with bald eagles, coyotes, California condors, and white-tailed eagles for prey items. They most likely also compete with common ravens, gyrfalcons, peregrine falcons, rough-legged hawks and other species for territories.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Golden eagles have few predators. There is no record of predation of golden eagle eggs, and few records of adult or nestling predation. Wolverines and grizzly bears are the only recorded predators of golden eagle nestlings.

Known Predators:

  • wolverines (Gulo gulo)
  • grizzly bears (Ursus arctos)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecosystem Roles

Golden eagles impact the populations of the animals that they prey on. They may also compete with other species for prey and habitat, including Haliaeetus leucocephalus, Canis latrans, Gymnogyps californianus, and Haliaeetus albicilla. They also probably compete with other large birds for habitat. These other birds Corvus corax, Falco rusticolus, Falco peregrinus, Buteo lagopus and other species.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Golden eagles have few predators. There is no record of predation of golden eagle eggs, and few records of adult or nestling predation. Gulo gulo and Ursus arctos are the only recorded predators of golden eagle nestlings.

Known Predators:

  • wolverines (Gulo_gulo)
  • grizzly bears (Ursus_arctos)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Aquila chrysaetos preys on:
Marmota
Lepus californicus
Lepus townsendii
Sylvilagus
Spermophilus
Mammalia
Aves
Serpentes
Anser anser
Larus californicus
Tyto alba
Corvus corax
Nucifraga columbiana
Spermophilus beecheyi
Spermophilus washingtoni
Capra ibex
Marmota bobak
Marmota caudata

Based on studies in:
USA: Montana (Tundra)
USA: California, Cabrillo Point (Grassland)
USA: California, Coachella Valley (Desert or dune)

This list may not be complete but is based on published studies.
  • D. L. Pattie and N. A. M. Verbeek, Alpine birds of the Beartooth Mountains, Condor 68:167-176 (1966); Alpine mammals of the Beartooth Mountains, Northwest Sci. 41(3):110-117 (1967).
  • L. D. Harris and L. Paur, A quantitative food web analysis of a shortgrass community, Technical Report No. 154, Grassland Biome. U.S. International Biological Program (1972), from p. 17.
  • Myers, P., R. Espinosa, C. S. Parr, T. Jones, G. S. Hammond, and T. A. Dewey. 2006. The Animal Diversity Web (online). Accessed February 16, 2011 at http://animaldiversity.org. http://www.animaldiversity.org
  • Polis GA (1991) Complex desert food webs: an empirical critique of food web theory. Am Nat 138:123–155
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Comments: The global number of occurrences has not been precisely determined using standardized criteria, but this species clearly is represented by a large number of occurrences (subpopulations).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Comments: North American population in the mid-1980s was estimated at about 70,000; perhaps about 20,000 breeding pairs occur in the western United States. De Smet (1987 COSEWIC report) gave an estimate of 50,000-100,000 for North America. Kirk et al. (1995) reported that the estimated number of breeding pairs in Canada was 1,000-5,000. Rich et al. (2004) estimated global population size at 170,000, with approximately half of the total in the United States and Canada.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Habitat-related Fire Effects

The golden eagle occurs in the following six major fire-dependent plant
associations in the western United States: grassland, semidesert
grassland-shrub, sagebrush-grassland, pinyon-juniper woodland, and
ponderosa pine and Douglas-fir (Pseudotsuga menziesii) forests [29].

In addition to potentially affecting nest trees, fire may kill perch and
roosting trees. These snags are used by golden eagles for nesting,
perching and/or roosting. Use of trees probably depends more on
proximity to prey than condition (live or dead). Migrating golden
eagles use fire-killed snags near openings for perching and roosting in
subalpine areas of Glacier National Park, Montana [30].

Fires probably enhance the prey base and hunting efficiency of golden
eagles. Regular burning helps to keep habitats in a suitable condition
for many prey species of the golden eagle and increases hunting
efficiency [15]. In forested areas of the East, golden eagles forage on
burns, though they may prefer bogs [21]. Golden eagles were seen using
recently burned sites in the Lincoln National Forest, New Mexico.
Golden eagles there were probably taking advantage of abundant prey
associated with the growth of new vegetation on the burned site [29].
Fire suppression in this century has contributed to the loss of golden
eagle breeding pairs in the Appalachian Mountains of the eastern United
States. Historically, open areas used by golden eagles for foraging in
those mountains were maintained by fire. After full suppression
policies began, the openings reverted to brush and eventually to
forest. Today, there are few openings in the Appalachian Mountains; as
a result, the golden eagle has almost disappeared [24].

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Timing of Major Life History Events

More info for the term: cohort

Age at sexual maturity - Golden eagles are sexually mature at
4 or more years of age [16].

Breeding season - The golden eagle breeding season generally occurs from
mid-January to mid-September, but varies according to geographic area
[22,27].

Clutch size and incubation - The golden eagle lays one to three eggs,
with two eggs most common [9,21,27]. The eggs are incubated for 35 to
45 days [9].

Fledging - Nestlings fledge at 9 to 10 weeks and remain in the vicinity
of the nest. The parents provide food for the fledglings until they are
about 14 weeks old or older [9].

Migration - Migration varies with population and cohort and is a
function of both food supply and climate. Golden eagles in the
subarctic and at least some golden eagles of all ages in northern boreal
areas migrate. They travel south along high ridges in the Intermountain
West during September and October. In the East they traverse the ridges
of the Appalachians to the southern highlands from September through
November. In a zone near the United States-Canada boundary, resident
breeders and older prebreeders migrate short distances in severe winters
and/or when food is scarce [21]. In the mountainous West, golden eagles
often move down from the mountains onto the plains and valleys during
the winter [8]. Breeding golden eagles prefer to maintain their
nesting-hunting territories or travel the shortest distance necessary to
survive prolonged cold or heat, while older prebreeders may be less tied
to specific locations. Birds of the youngest cohort are often
migratory. In the arid Southwest, golden eagles move to high elevations
after breeding [21].

Longevity - Golden eagles in captivity have lived 41 to 48 years, but it
is unlikely that many live that long in the wild [9].

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Golden eagles are mostly silent, except during the breeding season. They use nine different calls to communicate. Most calls appear to be associated with food delivery to nestlings and begging by the nestlings.

Golden eagles don't appear to use vocalizations to mark their territory. Instead, they use an undulating flight to defend the boundaries of their territory.

Communication Channels: visual ; acoustic

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Communication and Perception

Golden eagles are mostly silent, except during the breeding season. They use nine different calls to communicate. Most calls appear communicate about food. Golden eagles don't use vocalizations to mark their territory. Instead, they mark the edges of their territory by flying around them.

Communication Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cyclicity

Comments: Foraging commonly occurs in early morning and early evening.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

The oldest known golden eagle lived to 46 years in captivity. In the wild, golden eagles have been known to live up to 32 years.

Range lifespan

Status: wild:
48 (high) years.

Range lifespan

Status: captivity:
46 (high) years.

Average lifespan

Status: wild:
340 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan/Longevity

The oldest known golden eagle lived to 46 years in captivity. In the wild, golden eagles have been known to live up to 32 years.

Range lifespan

Status: wild:
48 (high) years.

Range lifespan

Status: captivity:
46 (high) years.

Average lifespan

Status: wild:
340 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 48 years (captivity) Observations: In captivity, these animals have been reported to live up to 48 years (http://www.fs.fed.us/database/feis/).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Golden eagles are monogamous, and may maintain pair bonds for several years. In non-migrant populations, pairs appear to stay together year round. For migratory golden eagles, pair formation and courtship begin when the eagles return to the breeding grounds, between February and mid-April. There is no information available regarding whether pair bonds are maintained year-round in migratory populations. Courtship activities in this species include undulating flight by one or both members of the pair, chases, dives, mock attacks, presenting talons, soaring together and circling.

Mating System: monogamous

Golden eagles breed from March through August, depending on their geographic location. Golden eagle pairs in much of the range are sedentary, remaining in the same territory year round. These pairs may begin nest-building and courtship as early as December. For migratory golden eagles, pair formation and courtship begin when the eagles return to the breeding grounds, between February and mid-April. Pairs may have several nests in their breeding territory and often re-use nests year after year, refurbishing them before each breeding season. Golden eagles usually build their nests on cliffs, but may also use trees, riverbanks and man-made structures, such as windmills, observation towers, nest platforms, and electrical towers. Nests are built 0 to 107 m off the ground. Both the male and female of a pair refurbish or build the nest, which may take 4 to 6 weeks. Nests are constructed of sticks and local vegetation and lined with soft vegetation, including shredded yucca, grasses, dry yucca leaves, inner bark, dead and green leaves, mosses and lichens. Nests may be huge if the site allows. The largest nest on record measured 6.1 m tall and 2.59 m wide.

The female lays 1 to 4 (usually 2) eggs, with 3 to 4 day intervals between each egg. The female begins incubating after the first egg is laid, and is responsible for most of the incubation, though the male often takes part. The eggs are dull white and spotted or blotched with brown or reddish brown. Incubation lasts for 35 to 45 days (average 42 days). The young hatch several days apart, and are altricial. The older nestlings are usually much larger than the younger nestlings, and the older, stronger eaglets often kill their smaller siblings. The chicks are brooded by the female with decreasing frequency for the first 45 days or so. Both parents bring food to the nestlings. The nestlings begin to leave the nest between 45 and 81 days of age by walking, hopping or falling out of the nest. They begin to fly around 10 weeks of age, and become independent from the parents 32 to 80 days after fledging. Juveniles do not breed until age 4 to 7 years, after attaining adult plumage.

Breeding interval: Golden eagles breed once yearly.

Breeding season: Golden eagles breed from March through August, depending on their geographic location.

Range eggs per season: 1 to 4.

Average eggs per season: 2.

Range time to hatching: 35 to 45 days.

Average time to hatching: 42 days.

Range fledging age: 45 to 81 days.

Range time to independence: 32 to 80 days.

Range age at sexual or reproductive maturity (female): 4 to 7 years.

Range age at sexual or reproductive maturity (male): 4 to 7 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Average eggs per season: 2.

Female golden eagles are primarily responsible for incubation, though males may do some of the incubation. The female also broods the chicks for much of the time in the first 45 days after hatching. Both parents bring food to the nest, though the male provides the majority of food, especially in the first few weeks after hatching.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female)

  • Kochert, M., K. Steenhof, C. McIntyre, E. Craig. 2002. Golden Eagle (Aquila chrysaetos). Pp. 1-44 in A Poole, F Gill, eds. The Birds of North America, Vol. 684. Philadelphia: The Birds of North America.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Egg dates: by late April in northern Alaska (later if snow persists); peak in late February-March in the region from California to Texas (but earlier nesting may yield young ready to fly as early as March 1 in Texas); late February-early March in Utah; March-April in northeastern United States. Clutch size is 1-3, rarely 4 (usually 2). Incubation, mostly by the female, lasts about 43-45 days. Young can fly at 60-77 days (fledging takes longer in the far north than in the southern part of the range). Young are cared for by parents for 30+ additional days; family unit sometimes may remain together several months. Typically first breeds in 4th or 5th year. Lifelong monogamy may be the rule, though some apparent exceptions have been recorded. A positive correlation between breeding success and jackrabbit number was reported in Idaho, Colorado, and Utah. Distance between active nests almost never is less than 0.8 km. See Palmer (1988) for further details on reproduction.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Golden eagles are monogamous, and pairs may breed together for several years. In sedentary populations, pairs stay together year round. Golden eagle courtship includes the pair flying together, chasing, diving and pretending to attach each other.

Mating System: monogamous

Golden eagles breed between March and August. Some golden eagles are sedentary, remaining in the same territory all year. These eagles may begin building their nests and forming pairs as early as December. Migratory golden eagles don’t begin pair formation and courtship until they return to the breeding grounds in early spring. Many pairs re-use the same nest for many years. Golden eagles usually build their nests on cliffs, but may also use trees, riverbanks and man-made structures, such as windmills, observation towers, nest platforms, and electrical towers. Nests are built 0 to 107 m off the ground. The male and female both build the nest. This takes 4 to 6 weeks. Nests are made of sticks and lined with soft vegetation, such as grasses, dry yucca leaves, inner bark, dead and green leaves, mosses and lichens. Some golden eagle nests are huge. The largest nest was 6.1 m tall and 2.59 m wide.

The female lays 1 to 4 (usually 2) eggs. She lays one egg every 3 to 4 days. The female incubates the eggs for 35 to 45 days (average 42 days). The chicks hatch several days apart, and are helpless (altricial). The older nestlings are usually much larger than the younger nestlings, and the older, stronger eaglets often kill the smaller chicks. The female parent broods the chicks regularly for up the first 45 days or so. Both parents bring food to the nestlings. The nestlings begin to leave the nest when they are 45 to 81 days old. They first leave the nest by walking, hopping or falling out of it. They begin to fly when they are about 10 weeks old, and become independent from their parents 32 to 80 days after fledging. Golden eagles begin to breed when they are 4 to 7 years old.

Breeding interval: Golden eagles breed once yearly.

Breeding season: Golden eagles breed from March through August, depending on their geographic location.

Range eggs per season: 1 to 4.

Average eggs per season: 2.

Range time to hatching: 35 to 45 days.

Average time to hatching: 42 days.

Range fledging age: 45 to 81 days.

Range time to independence: 32 to 80 days.

Range age at sexual or reproductive maturity (female): 4 to 7 years.

Range age at sexual or reproductive maturity (male): 4 to 7 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Average eggs per season: 2.

The female golden eagle of a pair does most of the incubation. She also broods the chicks much of the time for the first 45 days after hatching. Both parents bring food to the nest, but the male provides more food than the female.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female)

  • Kochert, M., K. Steenhof, C. McIntyre, E. Craig. 2002. Golden Eagle (Aquila chrysaetos). Pp. 1-44 in A Poole, F Gill, eds. The Birds of North America, Vol. 684. Philadelphia: The Birds of North America.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Aquila chrysaetos

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACACTTATCAATCGATGACTATTCTCAACCAACCACAAAGACATCGGCACTCTATACCTAATCTTCGGCGCATGGGCTGGCATAGTCGGCACCGCCCTTAGCCTTCTTATCCGCGCAGAACTTGGCCAACCTGGCACCCTCTTAGGCGATGACCAAATCTACAATGTAATCGTCACCGCTCATGCTTTCGTAATAATCTTCTTCATAGTCATACCAATCATAATTGGAGGCTTTGGAAACTGACTTGTCCCACTCATAATTGGCGCCCCCGACATAGCCTTCCCACGCATAAACAACATGAGCTTCTGATTACTCCCCCCATCCTTCCTCCTCCTACTAGCCTCTTCAACAGTAGAAGCAGGGGCTGGCACCGGGTGGACTGTCTACCCCCCACTAGCCGGCAACATAGCCCACGCCGGCGCTTCGGTAGACCTAGCTATCTTTTCCCTCCATCTAGCAGGTATCTCATCCATCTTAGGGGCCATTAACTTTATCACAACAGCCATTAACATAAAACCCCCAGCCCTCTCCCAATACCAAACACCCCTATTCGTATGATCCGTTCTTATTACCGCTGTCCTACTATTACTCTCACTCCCCGTCCTAGCTGCTGGCATCACTATATTACTTACAGACCGAAACCTCAACACAACATTCTTCGACCCCGCTGGCGGCGGTGACCCAATTCTGTACCAACACCTCTTCTGATTCTTCGGACACCCCGAAGTCTACATCCTAATTCTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Aquila chrysaetos

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2015

Assessor/s
BirdLife International

Reviewer/s
Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (extent of occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2013
    Least Concern (LC)
  • 2012
    Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5