Overview

Distribution

The gyrfalcon (Falco rusticolus) is an arctic dwelling species with a holarctic distribution. It is rarely found south of 60 degrees. The majority of the breeding range is found north of 60 degrees while in parts of Eastern Canada it can be found breeding to 55 degrees, mainly along sea coasts. Although gyrfalcons are non-migratory, they will disperse from the breeding range during the winter season, very rarely reaching the northern limit of the United States (Poole 1987; Wheeler and Clark 1995; Cade 1982).

Biogeographic Regions: nearctic (Native ); palearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Holarctic. BREEDS: in Alaska (see Johnson and Herter [1989] for details), northern Canada, Greenland, Iceland, northern Scandinavia, northern Russia, and northern Siberia. WINTERS: south to mid-Europe, Japan, southern Canada, and irregularly to the northern coterminous U.S.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Mountains and tundra of n Palearctic region and n North America.
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

The world's largest falcon is polymorphic, being recognized in three color phases: white, grey, and dark. The dark phase is dark grey, almost black, in some individuals and groups of this morph are found in northern Canada. The white morph is generally found in Greenland, and is usually almost pure white with some markings usually on the wings. The grey morph is an intermediate and found throughout the range, typically two tones of grey are found on the body, most easily beind seen on the flight feathers versus the rest of the wing. This species is sexually dimorphic and thus has a wide ranging weight. Males weigh 800-1300g, averaging 53cm total length and females weigh 1400-2100g, averaging 56cm total length. The shape of the gyrfalcon is characteristically the same as most falcons. This includes long pointed wings (unlike the rounded wings of buteos), long tail and a notched bill. It also however, differs from other falcons by large size, shorter wings that only extend 2/3 down the tail when perched (compared with other falcons where the wings extend all the way to the tail), and broader wings. Adults characteristically have yellow ceres, eye-rings and legs while juveniles display these features in a blue color. As in all falcons, the eyes appear black. This species may perhaps only be confused with the Northern Goshawk (Accipiter gentilis) which inhabits dense forests, or the Peregrine Falcon (Falco peregrinus) which is somewhat smaller with a dark slaty-blue-black "helmet" and a lighter underside(Wheeler and Clark 1995; Cade 1982).

Range mass: 800 to 2100 g.

Other Physical Features: endothermic ; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 64 cm

Weight: 2100 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The gyrfalcon is typically found in northern latitudes away from the boreal forest. Although some individuals have been recorded nesting in trees, the majority of individuals of this species nest in the arctic tundra. Nesting habitat is usually among tall cliffs while the hunting and foraging areas are more diverse. Foraging areas may include coastal areas and beaches that are used heavily by waterfowl, stooping off cliffs at unsuspecting prey such as small birds beneath them, or on the open tundra where tail chases on ptarmigan and larger mammals is common.

Habitat fragmentation is currently not a threat to this species, due mainly to the short growing season and climate of the area. Since cliff faces are not disturbed and the tundra is not highly altered nor farmed, habitat for this species seems to be stable.

Winter can force this species to move regionally to feed. While in more southern climates, they prefer agricultural fields which remind them of their northern breeding grounds, typically perching low to the ground on fence posts (Pletz, E. 2000 personal communication; Poole 1987).

Terrestrial Biomes: tundra

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Primarily open country in the Arctic, including tundra, open coniferous forest, mountainous regions, and rocky seacoasts; generally in coastal areas in winter (AOU 1983, National Geographic Society 1983).

Usually nests on cliff ledges, ideally beneath sheltering overhang; sometimes nests in trees or on man-made structures. Nest generally is a scrape on a rock ledge or an abandoned hawk or raven nest. May nest on same cliffs as does peregrine. May compete successfully with peregrine for nest sites. May change nest site in successive years.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Overwinters as far north as available prey allows. Many individuals, especially those from the high arctic, migrate south for winter (especially juveniles and prebreeders); migrant females arrive on breeding areas mid-February to early March (Cade 1982). Satellite telemetry has documented migrations between Alaska and eastern Asia (Britten et al. 1995).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Unlike eagles which use their large size to rob meals, and peregrine falcons which use gravity to gain tremendous speed, the gyrfalcon uses raw power to capture prey, usually in a tail chase. Usually low coursing flights are used in open habitat (no trees for concealment) where gyrfalcons will strike prey both in the air or on the ground . The majority of prey (by biomass) that consitutes the diet consists of ptarmigan (Lagopus sp.), Arctic ground squirrel (Spermophilus parryii) and Arctic hares (Lepus arcticus). Other prey includes other small mammals (mice and voles) as well as other birds (ducks, sparrows, buntings)

While hunting, this falcon uses keen eyesight to spot potential prey, as almost all animals in the north are cryptically colored to avoid detection. When potential prey is spotted a chase usually occurs where more than likely the prey will be knocked to the ground in a powerful blow from the talons and then pounced upon. Gyrfalcons are powerful enough to have sustained flight while hunting and occasionally wear their prey out until capture is easy. During nesting, the gyrfalcon will also cache meals with large prey such as Arctic hares between feedings. Rock doves (Columba livia), or pigeons as they are commonly known, although not native are preyed upon heavily in major centers by gyrfalcons during winter months (Lange and Dekker 1999; Stelfox and Fisher 1998; Cade 1982; Poole 1987).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Diet mostly consists of birds (especially ptarmigans which make up 85-95% of their diet by weight, although other birds of prey, ducks, auks, gulls, and terns are locally important). Small mammals are important in some areas and to young birds (Cade 1982). Primary prey in central Canadian arctic: rock ptarmigan, arctic ground squirrel, and arctic hare (Poole and Boag 1988). Takes most prey from the ground rather than from the air. See Palmer (1988) for many details.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Known prey organisms

Falco rusticolus preys on:
Asio flammeus

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Global Abundance

10,000 to >1,000,000 individuals

Comments: Estimated number of breeding pairs in Canada in the early 1990s was 1500-3000 (Kirk et al. 1995). See Palmer (1988) for population estimates for various regions.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Distance between nest sites was 3-38 km in northern Alaska; average of 10.4 km for inland sites in Greenland, minimum of 15 km for coastal sites in Greenland. Hunted up to 12-15 km from aerie in interior Alaska (see Palmer 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Average lifespan

Status: wild:
162 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 13.5 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Gyrfalcons nest in the remote northern portions of the world. Until recently, little was known about nesting sites, incubation times, fledging dates, or reproductive behavior. Although much has been discovered recently, many other aspects of the reproductive cycle have yet to be determined.

Males begin defending nesting territory in mid-winter, about the end of January, while females generally arrive at nesting sites near the beginning of March. Pair bonding occurs for about 6 weeks and subsequently the eggs are usually laid near the end of April.

Gyrfalcons do not construct their own stick nests in trees (although old common raven (Corvus corax) stick nests in trees are sometimes used), and usually find suitable nesting sites on cliff faces where there is a shelf with an overhang. Nest sites are used year after year and accumulate prey remain piles, while the rocks turn white from excessive guano.

The clutch can be from 2-7 eggs, however,the average size is 4, which is typically incubated by the female with some assistance from the male. Incubation has recently been determined to be 35 days and all birds in the clutch hatch within a 24-36 hour period.

Due to cold climate, chicks are covered in heavy down and are left to thermoregulate themselves after only 10 days as the female leaves the nest to join the male in hunting duties for the growing family (Cade 1982).

Key Reproductive Features: iteroparous ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Pair-bonds form over 6-8 weeks before egg laying (April-early May or into June). Clutch size most commonly is 3-4. Incubation lasts about 5 weeks (but 44 days also reported), mainly by female, which broods young 10 days, then aids in food provision until fledging at 7-8 weeks (late June to mid-Aug. in Beaufort Sea area). Young are dependent for another month or more. First breeds probably at 2 years.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Falco rusticolus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTTTCTCCAACCCACAAAGACATTGGCACCCTATACCTACTCTTCGGAGCATGAGCAGGCATAGTCGGCACTGCCCTTAGCCTCCTTATTCGAACAGAACTTGGCCAACCAGGGACTCTCCTAGGAGATGACCAAATCTACAATGTCATTGTCACCGCCCATGCCTTCGTAATAATCTTTTTCATAGTCATACCCATTATGATCGGAGGATTTGGAAACTGACTAGTCCCCCTTATAATTGGAGCCCCAGACATAGCATTCCCCCGCATAAACAACATGAGTTTCTGACTGCTCCCCCCATCCTTTCTACTACTCCTAGCATCTTCCACAGTAGAAGCGGGAGTTGGAACAGGATGAACCGTATACCCCCCCTTAGCAGGCAACCTAGCCCATGCCGGTGCTTCAGTAGACCTCGCCATTTTCTCCCTACACCTTGCAGGTGTATCTTCCATCTTAGGGGCAATCAACTTTATCACAACAGCCATTAACATAAAACCACCCGCCCTATCACAATATCAAACCCCACTATTCGTATGATCCGTACTTATCACCGCCGTACTCCTGCTTCTCTCACTTCCAGTTCTAGCTGCTGGCATCACCATACTACTAACCGACCGAAACCTAAACACTACATTCTTCGACCCCGCCGGAGGAGGAGACCCCATTCTCTATCAACACTTATTCTGATTCTTCGGCCACCCAGAAGTTTACATCCTAATCCTCCCAGGATTTGGAATTATCTCCCACGTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Falco rusticolus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2015

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (extent of occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2012
    Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Near Threatened (NT)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5