Articles on this page are available in 1 other language: Spanish (13) (learn more)

Overview

Brief Summary

Falco sparverius

The smallest falcon in North America (9-12 inches), the American Kestrel is most easily identified by its small size, rufous-brown tail, and rufous-brown back with dark horizontal bars. Other field marks include a white throat, white cheeks, and a slate-blue head with a rufous crown. Male American Kestrels have slate-blue wings, while females are larger and have rufous wings. The American Kestrel breeds across a wide portion of North America from Alaska and Canada to central Mexico. In winter, American Kestrels withdraw from northern portions of their range, wintering from the north-central United States south to Panama. Many American Kestrels in southern portions of this species’ breeding range are non-migratory, as are other populations in Central America, the West Indies, and South America. American Kestrels inhabit a number of open habitats, including grasslands, fields, meadows, and urban areas, that provide cavities for nesting as well as open areas for hunting. This species utilizes similar habitat types in winter as in summer, although nesting cavities are not necessary in that season. American Kestrels eat a variety of small animals, including insects, small birds, and rodents. Due to this species’ preference for open habitat, American Kestrels may be most easily seen perched prominently, perhaps in a tree or on a utility pole, while watching for prey. This species may also be observed hunting, when it may be seen pursuing and capturing prey with its talons. American Kestrels are primarily active during the day.

Threat Status: Least Concern

  • American Kestrel (Falco sparverius). The Internet Bird Collection. Lynx Edicions, n.d. Web. 20 July 2012. .
  • Falco sparverius. Xeno-canto. Xeno-canto Foundation, n.d. Web. 20 July 2012. .
  • Peterson, Roger Tory. Birds of Eastern and Central North America. Boston: Houghton Mifflin, 1980. Print.
  • Smallwood, John A. and David M. Bird. 2002. American Kestrel (Falco sparverius), The Birds of North America Online (A. Poole, Ed.). Ithaca: Cornell Lab of Ornithology; Retrieved from the Birds of North America Online: http://bna.birds.cornell.edu/bna/species/602
  • eBird Range Map - American Kestrel. eBird. Cornell Lab of Ornithology, N.d. Web. 20 July 2012. .
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Institution

Supplier: DC Birds

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Distribution

The American kestrel permanently inhabits (without seasonal migration) North and South America from near the tree-line in Alaska and Canada and south to Tierra del Fuego. The bird can also be found in the West Indies, the Juan Fernandez Islands and Chile. It is largely absent from heavily forested areas, including Amazonia.

Biogeographic Regions: nearctic (Native ); neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: BREEDS: central Alaska and most of forested Canada south through most of North, Central, and South America and the West Indies (including Puerto Rico and the Virgin Islands) to Tierra del Fuego. NORTHERN WINTER: from northern U.S., and locally in southern Canada, southward (Godfrey 1966). In the U.S., most abundant in winter in the western and southern states (Root 1988). See Palmer (1988) for more detail.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

American Kestrels are found in the Nearctic and Neotropical regions. They live in North and South America from near the tree-line in Alaska and Canada to southernmost South America. Their range extends to the West Indies, the Juan Fernandez Islands, and Chile. They are not typically found in rainforest areas and they do not migrate long distances.

Biogeographic Regions: nearctic (Native ); neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

American kestrels breed from western and central Alaska and southern
Yukon to northern Ontario, southern Quebec, and southern Newfoundland
south to Mexico.  They winter from south-central Alaska, southern
British Columbia, and northern United States south throughout the
breeding range to Panama [1,2,13,15,25].  Specific distributions of the
four North American subspecies are listed below:

Falco sparverius sparverius- Breeds from east-central Alaska and the
Northwest Territories east to Nova Scotia and south to northern Mexico,
southern Texas, Arkansas, Tennessee, northern Alabama, and northern
Georgia.  This subspecies winters from southern British Columbia to
southern Ontario and New York, south to Nevada, the Gulf Coast of the
United States, Florida (to Key West), and the Bahama Islands; through
Mexico and Central America to eastern Panama [1].

Falco sparverius guadalupensis is a resident subspecies on Guadalupe
Island and in Baja California [1].

Southeastern American kestrels- This subspecies has now been extirpated
over most of its former range [34].  The current range of southeastern
American kestrels was not described in the literature.  Former breeding
range extended from Louisiana (except the coastal area), Mississippi,
central Alabama, and southern Georgia to southern Florida.  Former
winter range extended from their breeding range south to the Gulf coast
of Louisiana and to Key West, Florida [1].

Falco sparverius peninsularis- Breeds in southern Baja California from
Santana south to Cape San Lucas and in the lowlands of Sonora and
Sinaloa.  Winters south to Mazatlan, Sinaloa [1].

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Regional Distribution in the Western United States

More info on this topic.

This species can be found in the following regions of the western United States (according to the Bureau of Land Management classification of Physiographic Regions of the western United States):

    1  Northern Pacific Border
    2  Cascade Mountains
    3  Southern Pacific Border
    4  Sierra Mountains
    5  Columbia Plateau
    6  Upper Basin and Range
    7  Lower Basin and Range
    8  Northern Rocky Mountains
    9  Middle Rocky Mountains
   10  Wyoming Basin
   11  Southern Rocky Mountains
   12  Colorado Plateau
   13  Rocky Mountain Piedmont
   14  Great Plains
   15  Black Hills Uplift
   16  Upper Missouri Basin and Broken Lands

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Occurrence in North America

AL AK AZ AR CA CO CT DE FL GA
HI ID IL IN IA KS KY LA ME MD
MA MI MN MS MO MT NE NV NH NJ
NM NY NC ND OH OK OR PA RI SC
SD TN TX UT VT VA WA WV WI WY
DC PR VI
AB BC MB NB NF NT NS ON PE PQ
SK YK MEXICO

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

male: 103g to 120g

female: 126g to 166g

Generally, the American kestrel is 19 - 21 cm in length with an average wingspan of 50 - 60 cm.

Excepting the Seychelles kestrel, the American kestral is the smallest species in the genus Falco. There is a strong selection for sexual dichromatism, with males being brightly and rufously colored and females having a more even tone.

Other Physical Features: endothermic ; bilateral symmetry

Average mass: 117 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

American Kestrels are the smallest falcon in North America. Males weigh between 103 and 120 grams. Females weigh between 126 and 166 grams. The length of the American Kestrel ranges from 19 to 21 centimeters. Their wingspan is between 50 and 60 centimeters. Both sexes have dark eyes, a notched beak, and unfeathered legs. Males have a rust colored back and tail, and blue wings. The tail has a black band. Females are rust colored with black bands on her wings and tail. Both sexes have white patches on their faces. On top of their head is a blue cap, which is usually brighter in males.

Range mass: 103.0 to 166.0 g.

Range length: 19.0 to 21.0 cm.

Range wingspan: 50.0 to 60.0 cm.

Other Physical Features: endothermic ; bilateral symmetry

Sexual Dimorphism: female larger; male more colorful

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 27 cm

Weight: 160 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Differs from peregrine falcon, merlin, and aplomado falcon in having a reddish back and tail and double black marks on sides of head; peregrine falcon is much larger. Smaller than the Eurasian kestrel (averages 34 cm long), which has only a single black mark on each side of the head.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The American kestrel nests in tree cavities, woodpecker holes, crevices of buildings, holes in banks, nest boxes or, rarely, old nests of other birds. The American kestrel is highly adaptable behaviorly and lives just about everywhere, as long as there is some open ground for hunting and conspicuous places on which to perch (e.g., telephone wires).

Terrestrial Biomes: taiga ; desert or dune ; savanna or grassland ; chaparral ; forest ; scrub forest ; mountains

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: BREEDING: Open or partly open habitat; prairies, deserts, wooded streams, burned forest, cultivated lands and farmland with scattered trees, open woodland, along roads, sometimes in cities.

Nests in natural holes in trees, abandoned woodpecker holes, holes in buildings or cliffs, abandoned magpie nests, and similar sites. Readily uses nest-boxes, which may dramatically increase density of nesting pairs in some areas (may use boxes put up for wood duck or goldeneye). In western Venezuela, nest cavities tend to face into prevailing winds (Balgooyen 1990). Rarely returns to breed in vicinity where reared, but breeders tend to return to their previous territories (Palmer 1988).

NON-BREEDING: Various open and semi-open habitats. In winter, males use less open habitats than do females (Smallwood 1987, Palmer 1988, Ardia and Bildstein 2001).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

American Kestrels nest in tree cavities, woodpecker holes, crevices of buildings, holes in banks, nest boxes or, rarely, old nests of other birds. American Kestrels are highly adaptable and can live just about anywhere, as long as there is some open ground for hunting and places on which to perch and have a good view of the surroundings, such as telephone wires.

Habitat Regions: temperate ; tropical ; terrestrial

Terrestrial Biomes: taiga ; chaparral ; forest ; mountains

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cover Requirements

More info for the term: cover

American kestrels most often select cavities with tight-fitting
entrances for nests, probably to protect the nest from ground predators
[10].  The need for cover does not seem to affect Foraging behavior.
When foraging, American kestrels are commonly found on high, exposed
perches where they can look out over wide stretches of grassland or
pasture to watch for prey [24].  They prefer to hunt in open areas
covered only by short and sparse ground vegetation [12,24].  During the
winter, the availability of shelters may be a limiting factor.  The
distribution of American kestrels wintering in Ohio was closely linked
to availability of old buildings and other sheltered roosts [12].

The thick understory created by pine regeneration in cut or unburned
forests in Florida may have an adverse effect on southeastern American
kestrel populations [26]. 

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Preferred Habitat

More info for the terms: cacti, natural, tree

American kestrels occupy a wide variety of open to semiopen habitats,
including farmland and urban areas from sea level up to 13,000 feet
(3,960 m) elevation [29,40].  They generally occur in any habitat that
contains an adequate prey base, perch sites, and (during the nesting
season) nesting sites [40].  In the Sierra Nevada, American kestrels
range up to alpine zones, mountain meadows, and other open areas in late
summer and fall, but winter at lower elevations [54].  In Montana, they
breed at forest edges and in groves, ranging out over adjoining
prairies, croplands, and badlands [40].  In Nevada, the highest
densities of both breeding and wintering American kestrels are often
located near agricultural areas or riparian vegetation that support an
abundant prey base.  Nesting densities in these preferred habitats often
exceeds one pair per square mile [25].  In British Columbia, American
kestrels commonly occupy quaking aspen (Populus tremuloides) groves,
woodland edges, river bottomlands, wooded lakeshores, farmlands, burns,
meadows, orchards, marshes, and bogs [13].

Southeastern American kestrels inhabit mostly open pine forests and
clearings where snags occur [27].  The decrease of isolated or scattered
pine snags in open habitats used by southeastern American kestrels was
closely correlated with the decline in the number of breeding pairs
[50].

Nesting habitat - Nest sites are usually located along roadways,
streams, ponds, or forest edges [15].  Nests may be reused from year to
year.  In Utah, twelve pairs used the same nest site for 2 consecutive
years and eight pairs used the same site again the third year [24].
Southeastern American kestrels often use the same nest site in
successive years [34].  However, Hammerstrom and Hart [23] found that
American kestrels in central Wisconsin did not use the same nest site in
succeeding years even after having raised a brood successfully.

American kestrels prefer to nest in natural cavities with tight-fitting
entrances, or in cavities excavated by other bird species in both live
trees and snags [15,24,29,40].  The diameter of 15 cavity openings used
by American kestrels in British Columbia ranged from 2.5 to 14.1 inches
(6.4-36 cm) [13].  Trees with a d.b.h. greater than 12 inches (30 cm)
are preferred [15].  The species of trees used differs among geographic
regions [13,24,56,58].  Cavities excavated by northern flickers
(Colaptes auratus) and natural cavities located 6.5 to 35 feet (2-10.7
m) above the ground are commonly used as nesting sites [24].  If
cavities are unavailable, American kestrels nest in a variety of sites
including niches in rocky cliffs, under the eaves of buildings, in old
black-billed magpie (Pica pica) nests, in cavities in cacti, in unused
chimneys, or in nest boxes [15,17,24,54].

Herron and others [25] reported that American kestrels in Nevada
generally nest about 20 feet (6 M) from the ground and seem to prefer an
easterly exposure.

Of 41 American kestrel nests in Utah, 28 were located in trees (19 in
old northern flicker holes, two in old magpie nests and seven in natural
cavities).  The species and number of trees used were 18 cottonwood
(Populus spp.), 3 poplar (Populus spp.), 3 willow (Salix spp.), 3 maple
(Acer spp.), 1 elm (Ulmus spp.), and one apple.  Two of the remaining
nests were located in rocky cliffs and the last 11 were found on
building tops [24].  In southeastern Montana and northern Wyoming, most
American kestrel nests were in cavities of ponderosa pine (Pinus
ponderosa) and cottonwood or in sandstone cliffs.  Other nests were in
fenceposts, under bridges, and in abandoned magpie nests.  The greatest
number of nests occurred in ponderosa pine stands.  The mean distance
between occupied nest sites on the survey plots was 0.4 miles (0.7 km)
[56].

In British Columbia, American kestrel nests were situated in woodpecker
holes or natural cavities in living and dead trees (73%), in man-made
structures (23%), and in holes in cliffs.  Sometimes nests of other
species of birds were used, including those of belted kingfishers
(Ceryle alcyon), black-billed magpies, and American crows (Corvus
bachyrhynchos).  Ponderosa pine (29%) and Douglas-fir (Pseudotsuga
menziesii) (10%) were the most often used species of coniferous trees;
important deciduous trees were black cottonwood (Populus trichocarpa)
(19%) and quaking aspen (8%).  Man-made structures included nest boxes
(17%), buildings, power poles, and fence posts [13].

Nests of southeastern American kestrels are commonly located in old
woodpecker holes in snags 12 to 35 feet (39-114 m) above the ground
[27].  Most nest cavities have been excavated by northern flickers,
red-headed woodpeckers (Melanerpes erythrocephalus), or red-bellied
woodpeckers (Melanerpes carolinus) [58].  In north-central Florida,
southeastern American kestrels nested most frequently in longleaf pine
trees.  Turkey oak and live oak (Quercus virginiana) were also occupied.
Natural cavities occurred solely in turkey oak, whereas all nest
cavities in longleaf pine were of woodpecker origin.  The frequent use
of longleaf pine in this study indicates that this tree species is
particularly important for southeastern American kestrels nesting in
north-central Florida.  Turkey oak snags may be important alternate nest
sites for southeastern American kestrels and may increase in importance
as longleaf pine becomes scarcer [58].

Foraging habitat - American kestrels generally forage in open habitats
that contain high perches [29].  They probably use perch sites in tree
islands and along forest edges.  They also hunt by hovering over areas
of short, open vegetation [15].  American kestrels usually search for
prey from elevated perches such as fenceposts, utility poles and wires,
live trees, snags, and rock outcrops [15,36,40].  They prefer perches 16
feet (5 m) high or higher to perches over 8 feet (2.5 m) high [22].
Fischer and others [20] found that American kestrels wintering in
central Utah predominantly used wire perches.  Poles and trees were used
less often.  In Venezuela, 25 feet (7.6 m) tall poles were more
acceptable for perches than 6 foot tall (1.8 m) poles [40]. 

Winter habitat - Winter habitat for American kestrels is generally the
same as nesting habitat, except that high elevation areas are not used
[15,29].  Several studies have found
differential habitat use by male and
female adult American kestrels in the southern United States and
northern Mexico.  In areas of winter segregation, females often occupy
the best habitats which often includes open areas covered with short or
sparse ground vegetation.  Males are found primarily in woodland
openings, along woodland edges, or in other less open habitats.  This
differential habitat use may be due to the males arriving on the
wintering grounds later than the females.  The females therefore may
establish their winter territories in the best habitats before the males
arrive [46,47].

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associated Plant Communities

More info for the terms: association, hardwood, succession, tree

American kestrels occupy nearly all open shrubland, grassland and forest
vegetation types [29,40,54].  In Montana, American kestrels prefer
cottonwood (Populus spp.) forests over sagebrush (Artemisia spp.),
shrubland, and pine (Pinus spp.)-juniper (Juniperus spp.) woodland [40].
In California, they prefer large tree stages of succession.  For
breeding in blue oak (Quercus douglasii) savannah and gray pine (Pinus
sabiniana)-oak (Quercus spp.) types, they prefer 40 to 70 percent crown
closure[54].

The sandhills habitats apparently provide the most suitable habitat for
southeastern American kestrels in Florida [34].  In north-central
Florida, southeastern American kestrels nest in longleaf pine (Pinus
palustris) flatwoods, old-growth slash pine (Pinus elliottii) and
longleaf pine-turkey oak (Quercus laevis) sandhills communities [26,50].
During a 1981 through 1982 nesting survey, southeastern American kestrel
densities were higher in former and existing areas of the longleaf
pine-turkey oak sandhills association (0.41 pairs/sq km) than in areas of
former and existing hardwood hammocks (0.14 pairs/sq km) [58].
Additionally, the sandhill communities, particularly the pine-oak
woodland habitats, provide quality foraging sites for this subspecies
[59].

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Cover Types

More info on this topic.

This species is known to occur in association with the following cover types (as classified by the Society of American Foresters):

More info for the term: cover

   American kestrels probably occur in most SAF Cover Types

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Plant Associations

More info on this topic.

This species is known to occur in association with the following plant community types (as classified by Küchler 1964):

   American kestrels probably occur in most Kuchler Plant Associations

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Ecosystem

More info on this topic.

This species is known to occur in the following ecosystem types (as named by the U.S. Forest Service in their Forest and Range Ecosystem [FRES] Type classification):

FRES10 White-red-jack pine
FRES11 Spruce-fir
FRES12 Longleaf-slash pine
FRES13 Loblolly-shortleaf pine
FRES14 Oak-pine
FRES15 Oak-hickory
FRES16 Oak-gum-cypress
FRES17 Elm-ash-cottonwood
FRES18 Maple-beech-birch
FRES19 Aspen-birch
FRES20 Douglas-fir
FRES21 Ponderosa pine
FRES22 Western white pine
FRES23 Fir-spruce
FRES24 Hemlock-Sitka spruce
FRES25 Larch
FRES26 Lodgepole pine
FRES27 Redwood
FRES28 Western hardwoods
FRES29 Sagebrush
FRES30 Desert shrub
FRES31 Shinnery
FRES32 Texas savanna
FRES33 Southwestern shrubsteppe
FRES34 Chaparral-mountain shrub
FRES35 Pinyon-juniper
FRES36 Mountain grasslands
FRES37 Mountain meadows
FRES38 Plains grasslands
FRES39 Prairie
FRES40 Desert grasslands
FRES41 Wet grasslands
FRES42 Annual grasslands
FRES44 Alpine

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Northern breeding populations (Alaska, most of Canada, parts of northern U.S.) migrate south to the southern U.S. and Mexico for the northern winter, but breeding pairs farther south may stay together in the same area all year. Some temperate breeders migrate south as far as Panama and probably northern South America (Hilty and Brown 1986). In some areas (e.g., Pennsylvania and Maryland), breeders may be resident whereas the young migrate (Palmer 1988). Winterers begin leaving Florida in February (almost all are gone by April); in southern states east of Rockies there is much movement from at least early March into April, in northern states mainly mid-March to mid-April; on southern Canadian prairie most spring movement occurs in the last 3 weeks of April, continuing to mid-May (Palmer 1988). Migration in Costa Rica occurs mainly September-October and March-April (Stiles and Skutch 1989). Much movement of migrants in Canada and northern U.S. occurs in September, decreasing rapidly around mid-October; arrival in Florida begins in September, lasts well into October; arrives in southern Central America beginning in mid-October (Palmer 1988). In Minnesota and perhaps elsewhere in eastern and mid-western North America, the movement south peaks in September, coinciding with the migration of large dragonflies (specifically Green Darners, ANAX JUNIUS), which are preyed upon extensively by the migrating kestrels (Nicoletti 1996, Iron 1998).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

In the summer, American kestrels hunt in the early morning and evening, eating large insects (mainly grasshoppers). During winter, they hunt throughout daylight hours and eat small mammals (mice and sparrow-sized birds), sandpiper chicks, lizards, scorpions and amphibians.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: In summer feeds on insects (e.g., grasshoppers and crickets) and small vertebrates (e.g., snakes, lizards, birds, mice, sometimes bats). In winter: in north, feeds mainly on birds and mice; arthropods in Florida (Smallwood 1987); large insects, anoles, and snakes in Costa Rica. During migration, at least in eastern North America, high counts coincide with the migration of Green Darners, ANAX JUNIUS. In September 1995 at Hawk Ridge, Minnesota, Nicoletti (1996) observed 28% of the passing kestrels feeding on Green Darners. Late in the day, 74% fed on darners. Nicoletti theorized that this food source was especially important for juveniles. Iron (1998) observed similar behavior in September 1997 on the north shore of Lake Ontario. Forages from perch or while in flight (e.g., hovering). See Palmer (1988) for extensive account of food and feeding.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

In the summer, American kestrels hunt in the early morning and evening, eating large insects (mainly Orthoptera). During winter, they hunt throughout the daylight hours and eat small mammals, mostly rodents, like Microtus pennsylvanicus and Peromyscus leucopus, and Passeriformes, Charadriidae, Squamata, scorpions, and Amphibia.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

American kestrels eat primarily insects during the summer, but also take
mice and other small mammals, birds, lizards, toads, frogs, and small
snakes.  They sometimes eat carrion [15,40,60].  During the winter in
northern latitudes they eat primarily small birds and rodents [17,24].

Invertebrates eaten by American kestrels include earthworms, spiders,
centipedes, scorpions, and insects of seven orders, including both
larvae and adult forms of Diptera, Lepidoptera, and Coleoptera.
Reptiles include five genera of lizards and at least six species of
snakes.  Over 30 species of birds are listed as prey:  They range in
weight from under 10 grams to over 150 grams.  About 30 species of
mammals have also been listed as prey, with a weight range similar to
that of the avian prey [60].  About seven genera of bats are listed as
prey [40].

Some specific prey items of American kestrels include grasshoppers,
dragonflies, crickets, June beetles, weevils, crayfish, snails, small
ground squirrels (Spermophilus spp.), wood rats (Neotoma spp.), pocket
gophers (Geomys spp.), red squirrels (Tamiasciurus hudsonicus),
chipmunks (Tamaia striatus, Eutamias spp.), least weasels (Mustela
rixosa), voles (Microtus spp.), cotton rats (Sigmodon spp.), house mice
(Mus musculus), and shrews (Sorex spp.).  Many house sparrows (Passer
domesticus) are taken in rural and urban areas [40].

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

American Kestrels play an important role in controlling populations of small mammals, particularly rodents, in open habitats.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Falconiformes and Strigiformes may prey on adult American kestrels. Most predation probably occurs on eggs, babies in the nest (called nestlings), and young birds. A list of possible predators is given below. American kestrels protect their young by nesting in cavities. Their sharp talons and keen eyesight may help to protect them from other predators.

Known Predators:

  • Bubo virginianus
  • Aquila chrysaetos
  • Buteo jamaicensis
  • Falconidae
  • Canis latrans
  • Procyon lotor
  • Mephitis mephitis
  • Lynx rufus
  • Corvus brachyrhynchos and Corvus corax 

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predators

Some potential avian predators of American kestrels include great horned
owls (Bubo virginianus), golden eagles (Aquila chrysaetos), red-tailed
hawks (Buteo jamaicensis), and prairie falcons (Falco mexicanus) [39].
Other potential predators that have been reported preying on other
raptor species and their clutches include coyotes (Canis latrans),
bobcats (Lynx rufus), skunks (Mephitis mephitis and Spilogale putorius),
raccoons (Procyon lotor), and crows and ravens (Corvus spp).

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Falco sparverius preys on:
Chaetodipus penicillatus
Columbidae
Carduelis
Toxostoma curvirostre
Carpodacus mexicanus
Calamospiza melanocorys
Amphispiza belli
Zonotrichia leucophrys
Sylvilagus
Dipodomys
Brachystosternus
Tropidurus
Elaenia
Loxigilla noctis
Tiaris
Trochilidae
Coereba flaveola
Anolis gingivinus
Anolis pogus
Orthoptera
Coleoptera
Chilopoda
Diplopoda
Eumeces fasciatus
Chordeiles minor
Dendroica petechia
Tamias dorsalis
Microtus californicus
Nyctinomops laticaudatus

Based on studies in:
USA: Arizona, Sonora Desert (Desert or dune)
Peru (Coastal)

This list may not be complete but is based on published studies.
  • H. W. Koepcke and M. Koepcke, Sobre el proceso de transformacion de la materia organica en las playas arenosas marinas del Peru. Publ. Univ. Nac. Mayer San Marcos, Zoologie Serie A, No. 8, from p. 24 (1952).
  • Myers, P., R. Espinosa, C. S. Parr, T. Jones, G. S. Hammond, and T. A. Dewey. 2006. The Animal Diversity Web (online). Accessed February 16, 2011 at http://animaldiversity.org. http://www.animaldiversity.org
  • P. G. Howes, The Giant Cactus Forest and Its World: A Brief Biology of the Giant Cactus Forest of Our American Southwest (Duell, Sloan, and Pearce, New York; Little, Brown, Boston; 1954), from pp. 222-239, from p. 227.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Average territory size was 109.4 ha and 129.6 ha in two western U.S. studies (Cade 1982); home range diameter during the breeding season ranged from about 0.5 to 2.4 km in different regions; see Palmer (1988) for further data.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat-related Fire Effects

More info for the terms: cover, frequency, fresh, marsh

American kestrels occur in the following 10 major fire-dependent plant
associations in the western United States:  grasslands, semidesert
shrub-grasslands, sagebrush (Artemisia spp.)-grasslands, chaparral,
pinyon-juniper (Pinus spp.-Juniperus spp.) woodland, ponderosa pine,
Douglas-fir, spruce-fir (Picea spp.-Abies spp.), redwood (Sequoia
sempervirens), and giant sequoia (Sequoiadendron giganteum) forests
[33].  American kestrels occur in fire-dependent longleaf pine
communities in the eastern United States [26,58].

Although fire may reduce potential nest trees, it may also create snags
for nest and perch sites and enhance the foraging habitat of American
kestrels.  In the Sierra Nevada, nesting American kestrels were two to
three times more numerous in a burned-over forest than in an unburned
forest nearby.  This difference was attributed to the greater
availability of nest cavities in the burned forest [4].  At Sagehen
Creek, California, American kestrels breed (but do not winter) in burned
forests and along edges between sagebrush and forest habitats.  American
kestrels do not use areas of thick cover because they require an open
understory in which to maneuver and visually locate prey.  American
kestrels often use fresh burns when foraging due to increased prey
visibility [16,32,49].  A decrease in the frequency of ground fires
leads to an increase in vegetative cover and, therefore, has a negative
impact on habitat quality for American kestrels [4,26].  In the Sierra
Nevada, Balgooyen [4] found that open areas created by a severe fire in
ponderosa pine and lodgepole pine (Pinus contorta)-red fir (Abies
magnifica) forests provided only temporary habitat for American
kestrels.  Eleven to twelve years after the fire, brush vegetation
including deerbrush (Ceanothus integerrimus) and snowbrush ceanothus (C.
velutinus) formed dense cover in the burned areas [4].

American kestrels are favored by fires that open up or clear
pinyon-juniper woodlands [35].  Raptors associated with pinyon-juniper
woodlands depend upon edges of openings created by fire and scattered
islands of unburned woodlands [16].  In pinyon-juniper woodlands on the
Humboldt National Forest, California, American kestrels were observed
only on burned areas and only during the second season.  Surveys were
conducted in only two seasons [35].

American kestrels congregate at both controlled and naturally occurring
fires to hunt along the edge (usually the windward side) for insects,
small mammals, and reptiles [40,49,57].  Howell [27] reported seeing 13
southeastern American kestrels feeding over a "raging" marsh fire.
During a January fire in scrublands near Immokalee, Florida, 15 American
kestrels were observed hunting along the approximate 492 feet (150 m)
windward edge of the fire.  The linear concentration (1 bird/10 m) was a
hundredfold greater than that on utility lines in the area that same
winter.  American kestrels preyed exclusively on insects which flew away
from the fire into the wind [49].

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Timing of Major Life History Events

Age at sexual maturity - Both sexes of American kestrels are capable of
breeding as yearlings [40].

Breeding season - The breeding season varies depending on geographic
area.  Pairs are sometimes formed from 6 to 14 weeks before laying
begins [40].  In Ontario, laying begins in early April [40].  In
California, American kestrels breed from early April to early September,
with peak activity between early June and late August [54].  In Montana,
courtship begins in May [17] and in Nevada, the breeding season occurs
from April to July [25].  In Florida, the southeastern kestrel generally
begins laying eggs in early or mid-April [7].

Clutch size and incubation - American kestrels generally lay three to
seven eggs [17,54].  They may raise two clutches in one season.  The
second clutch size is generally smaller than the first.  Yearlings lay
repeat clutches less often than do older birds.  American kestrels may
lay an additional clutch if the first clutch is destroyed [40].  The
eggs are incubated for 28 to 30 days [13,17,25,40].

Fledging - Nestlings fledge in 25 to 31 days [13,25,40].  Fledglings
continue to be fed by the parents until feather development is complete,
usually 12 days after nest departure [25,40].  The fledglings may
continue to stay with parents for 30 days or more [40].

Spring migration - Spring migration begins in February from northern
South America and Central America and begins in March in northern
Mexico.  In California, most birds have begun leaving wintering areas by
mid-February.  American kestrels wintering in Florida begin leaving in
February, and almost all have left by April.  In southern states from
the Rockies east, migration occurs from early March through April, and
in northern states mid-March to mid-April.  On the southern Canadian
prairies, most spring migration is in the last 3 weeks of April, but it
continues to about mid-May [40].

Fall migration - The juveniles leave the breeding range before the
adults [40] and mature female American kestrels generally arrive on
their wintering ground before males [46,47].  In warm climates some
adults stay on their breeding territories year-round [25].
Additionally, some American kestrels winter in northern urban areas that
have a year-round food supply and warm roosting places [40].

In Canada and the northern United States, fall migration begins in
September.  Arrival in Florida begins in September and lasts at least
well into October.  American kestrels arrive in southern Central America
south to Panama beginning in mid-October [40].  Southeastern kestrels
stay on their territories year-round [34].

Longevity - American kestrels have been reported to live up to 11 years
[40].  However, most do not live that long. Palmer [40] reported an
annual average survival of 12.6 months, the oldest bird being aged 9
years, 10 months.  Captives at the McGill University colony live an
average of 5 years and 2 months [40].

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Communication and Perception

American Kestrels have an alarm call which sounds like "killee killee killee."

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cyclicity

Comments: Hunts most actively in the morning and late afternoon; rests during the middle of the day.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Average lifespan

Status: wild:
176 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan/Longevity

One researcher estimated that the average lifespan of American Kestrels as 12.6 months. One bird was recorded as reaching 11 years and 9 year old kestrals are not uncommon. Average lifespan in a captive colony was 5 years.

Range lifespan

Status: wild:
11.0 (high) years.

Average lifespan

Status: captivity:
5.0 years.

Average lifespan

Status: wild:
176 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 17 years (captivity) Observations: In captivity, these animals live about 5 years compared to little over 1 year in the wild. The maximum longevity reported in the wild is 9.8 years (http://www.fs.fed.us/database/feis/). There is also anecdotal evidence suggesting one animal was alive at age 17 (John Terres 1980).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

For up to six weeks before egg laying, females are promiscuous, mating with two or three males. Once a female settles with one mate, the pair mate frequently until egg laying. Three to seven eggs are laid (usually 4 or 5) over a period of 2 or 3 days. Eggs are white, cream or pale pink with an average size of 35 x 29 mm. Laying dates vary with geographical location:

Chile: September - October

Trinidad: May

Curacao: January

Florida: mid-March - early June

Central USA: mid-April - early June

Canada: late May - mid-June

The female does most of the incubation, but males have been known to occasionally sit. Both sexes have brooding patches. Incubation lasts 29 - 30 days and hatched chicks are non-competitive. Once chicks have hatched, females beg food from males. The female, in turn, feeds the young for the first 20 days. After that period, chicks beg for food from males and feed themselves. After 30 days, chicks leave the nest. The family remains as a unit for some time. The survival rate of chicks is about 50% under natural conditions, but it is usually higher under better conditions (e.g., human-provided nesting boxes).

Key Reproductive Features: iteroparous ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Average time to hatching: 29 days.

Average eggs per season: 5.

Average age at sexual or reproductive maturity (male)

Sex: male:
365 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
365 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

See Palmer (1988) for egg dates. Clutch size is 3-7 (usually 4-5). Incubation mainly by female, lasts usually 29-31 days. Two broods a year may be raised in some areas (e.g., central North America [Toland 1985], Chile). Young are tended by both parents, leave nest in about 29-31 days, may stay with parents for 2-4 weeks or more (no later than late summer in U.S.). Readily lays replacement clutch if first clutch is lost. Most first breed at 1 year. Monogamy through successive breeding seasons seems to prevail (Palmer 1988). Nesting density varies greatly throughout range, depending on nest-site availability and probably food supply; may tolerate close nesting by other pairs in some regions.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

American Kestrels are cavity nesters, though they will sometimes nest on cliffs. The female lays 3 to 7 eggs (usually 4 or 5) over a period of 2 or 3 days. Eggs are white, cream or pale pink with an average size of 35 x 29 mm. Females do most of the incubating, which means the females sit on the nest to keep the eggs warm until they hatch. Males have been known to incubate occasionally, and both sexes have brooding patches (patches on their belly where skin is not covered by feathers). Eggs hatch after 29 to 30 days of incubation. The young chicks are non-competitive, meaning they don't fight among themselves for food.

Breeding interval: American Kestrels raise one family of chicks per year.

Breeding season: Breeding season varies with region, in eastern North America the breeding season ranges from mid-April through June.

Range eggs per season: 3.0 to 7.0.

Range time to hatching: 30.0 (high) days.

Average fledging age: 30.0 days.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); oviparous

Average eggs per season: 5.

Average age at sexual or reproductive maturity (male)

Sex: male:
365 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
365 days.

Once chicks have hatched, females beg food from males. The female, in turn, feeds the young for the first 20 days. After that period, chicks beg for food from males and feed themselves on what he brings to the nest. After 30 days, chicks leave the nest. The family remains as a unit for some time. The survival rate of chicks is about 50% under natural conditions, but it is usually higher under better conditions, such as when using human-provided nesting boxes.

Parental Investment: altricial ; male parental care ; female parental care

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Falco sparverius

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 11 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACCGATGACTATTTTCAACAAACCACAAAGACATTGGCACCCTATACCTACTCTTCGGAGCATGAGCAGGCATAGCCGGCACTGCCCTCAGCCTCCTTATCCGAGCAGAACTCGGACAACCAGGAACCCTCCTAGGAGAT---GACCAAATCTACAATGTCATCGTCACCGCCCACGCCTTTGTAATAATCTTCTTCATAGTTATACCCATTATGATCGGAGGATTTGGAAACTGACTAGTCCCCCTTATAATTGGAGCCCCAGACATAGCGTTTCCACGCATAAACAACATAAGCTTCTGACTCCTCCCCCCATCCTTCCTACTACTCCTAGCATCCTCCACAGTAGAAGCTGGGGTTGGGACAGGATGAACCGTATACCCCCCCTTAGCAGGCAACCTAGCCCATGCTGGCGCCTCAGTAGACCTAGCCATCTTCTCCCTACACCTCGCAGGTGTATCTTCCATTCTGGGGGCAATCAACTTTATCACAACAGCCATCAACATAAAACCCCCCGCCCTATCACAATACCAAACCCCACTATTCGTATGGTCCGTTCTCATCACCGCCGTCCTCCTACTGCTTTCACTCCCAGTACTAGCTGCCGGCATCACCATACTATTAACTGACCGAAACCTAAACACTACATTCTTTGACCCTGCTGGAGGAGGAGACCCCATTCTCTATCAACACCTGTTCTGATTCTTCGGCCACCCAGAAGTTTACATCTTAATTCTCCCCGGCTTTGGAATCATCTCCCATGTTGTAGCATATTACGCAGGTAAAAAAGAACCATTCGGCTATATAGGAATAGTCTGAGCCATATTATCAATTGGATTCCTAGGCTTCATCGTATGAGCCCACCACATATTTACCGTAGGAATAGACGTAGACACCCGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Falco sparverius

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 15
Specimens with Barcodes: 24
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2015

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5