Articles on this page are available in 1 other language: Spanish (9) (learn more)

Overview

Distribution

Laughing falcons are found in the neotropical region. They are most common in Central America and tropical South America.

Biogeographic Regions: neotropical (Native )

  • Ferguson-Lees, J., D. Christie. 2001. Raptors of the World. London: Christopher Helm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Herpetotheres cachinnans typically has a large creamy yellow or whitish head with black coloring around its large owl-sized eyes creating what looks like a mask. It has a thick yellow bill. Its wings are short and only reach to the base of its tail. The cream colored tail is striped with black. Adults weigh between 400 and 800 g, are 40 to 47 cm in length and have wingspans of 25 to 31 cm. There is little size difference between the sexes, however, the female has a slightly longer tail and is slightly heavier.

Range mass: 400 to 800 g.

Average length: 40-47 cm.

Range wingspan: 25 to 31 cm.

Sexual Dimorphism: female larger

Other Physical Features: endothermic ; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Laughing falcon habitat includes open parts of tall forests as well as deforested country with scattered trees. Laughing falcons can also be found around forest clearings and edges. They can be found from sea level to elevations of 2500 m.

Range elevation: sea level to 2500 m.

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: forest ; rainforest

Other Habitat Features: agricultural

  • Brown, L., D. Amadon. 1968. Eagles, Hawks, and Falcons of the World. New York, NY: McGraw-Hill Book Company.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

The primary diet of laughing falcons consists of small snakes. The birds hunt from an open perch and then pounce on the snake. It is possible hear a thud as the bird kills its prey. Laughing falcons grip the snake behind the head, sometimes breaking it off. They have been known to occasionally eat lizards, bats, rodents and fish.

Animal Foods: mammals; reptiles; fish

Primary Diet: carnivore (Eats terrestrial vertebrates)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Because of their feeding habits, laughing falcons have an impact on the populations of the prey they eat.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

We do not have information on predation for this species at this time.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Herpetotheres cachinnans preys on:
Actinopterygii
Reptilia
Mammalia

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Laughing falcons communicate with a "laughing" call. They call in duets with the opposite sex for several minutes producing loud sounds that resemble laughter.

Communication Channels: acoustic

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

There was no information available regarding the lifespan of laughing falcons in the wild. The longest recorded lifespan in captivty is 14 years.

Range lifespan

Status: captivity:
14 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

There is little information about mating systems for laughing falcons. Most falcons (family Falconidae) are monogamous and they usually nest as solitary pairs. Laughing falcons use vocal performances to attract mates. Often pairs will sing in duets for minutes at a time near dusk and dawn.

The breeding season for laughing falcons varies with latitude. They usually lay one to two eggs per clutch. No information was available about the time to hatching for laughing falcons, however, for falcons in general hatching occurs after 45 to 50 days and the chicks fledge in about 57 days.

Breeding season: Varies with latitude

Range eggs per season: 2 (high) .

Average eggs per season: 1.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization ; oviparous

The parents share the incubation duties, although toward the time of hatching the female is reluctant to move from the nest. After the egg has hatched (45 to 50 days) the male assumes the role of hunter and the female tends to the young. It is extremely rare for a male laughing falcon to feed the young. No information was available regarding when parents stop feeding the young. However, in general, birds of prey decrease feeding slowly over time until the young are forced to fly from the nest and find food.

Parental Investment: no parental involvement; altricial ; pre-hatching/birth (Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female)

  • Brown, L., D. Amadon. 1968. Eagles, Hawks, and Falcons of the World. New York, NY: McGraw-Hill Book Company.
  • Ferguson-Lees, J., D. Christie. 2001. Raptors of the World. London: Christopher Helm.
  • del Hoyo, J., A. Elliott, J. Sargatal. 1994. Handbook of Birds of the World. Barcelona: Lynx Edicions.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Herpetotheres cachinnans

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TCTATACCTAATCTTCGGGGCATGAGCTGGCATAGTTGGTACTGCCCTCAGCTTACTCATCCGCGCAGAGCTCGGACAACCCGGAACCCTCCTGGGAGACGACCAAATCTACAACGTCATCGTCACCGCCCACGCCTTTGTAATAATTTTCTTTATAGTAATACCAATCATAATCGGCGGCTTTGGAAACTGACTAGTCCCACTCATAATTGGCGCCCCCGACATAGCATTTCCCCGTATAAACAATATAAGCTTCTGACTCCTCCCCCCATCATTCCTCCTTCTACTAGCTTCCTCTACAGTAGAAGCAGGAGCTGGCACTGGGTGAACCGTATATCCTCCCCTAGCTGGCAACCTAGCCCATGCAGGCGCCTCAGTAGACCTGGCCATCTTCTCCCTACATCTAGCAGGTGTATCCTCCATCCTCGGAGCAATCAACTTCATTACAACTGCCATCAACATAAAACCACCAACCCTCTCACAATACCAAACCCCTCTCTTCGTATGGTCCGTCCTCATTACCGCTGTCCTATTACTACTTTCACTCCCCGTCCTCGCTGCCGGCATTACCATGCTACTAACCGACCGAAACCTAAATACCACATTCTTCGACCCCGCCGGAGGAGGAGATCCCGTCCTATATCAACACCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Herpetotheres cachinnans

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5