Articles on this page are available in 3 other languages: Chinese (Simplified) (5), Spanish (9), Dutch (1) (learn more)

Overview

Brief Summary

Biology

The red knot is a long-distance migrant, covering between 5,000 and 15,000 kilometres, and stopping at least once along the way to feed and build up body fat and protein stores. It probes amongst the sand of estuaries and on shorelines for intertidal invertebrates, mainly small molluscs, but feeds also on crustaceans, horseshoe crab eggs and insects (2). Molluscs are ingested whole and cracked with their muscular gizzard. The size of its gizzard varies flexibly throughout the year, as a consequence of energetic demands and food quality (8). Red knots have unique sensory organs in their bill tips enabling them to detect buried prey without touching them, via water pressure differences in the sediment (comparable to the echolocation of bats) (9). Knots often form mixed species flocks with other shorebird species such as godwits (Limosa species), dunlins (Calidris alpina) and dowitchers (Limnodromus species) (5). Breeding in the tundra of the Arctic Circle, the red knot constructs a nest in a dip between lichen-covered rocks and lays three to four buff-coloured eggs spotted with brown. Both sexes incubate the eggs for 21 to 22 days, but the female departs immediately after hatching. The male takes care of the chicks up to fledging, which takes 18 to 20 days, and then leaves the tundra before the young, to head south to the wintering grounds. At the tundra, knots eat insects, beetles, spiders, small crustaceans, snails and worms (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Red knots are plump sandpipers with a short neck and sturdy legs. They are totally specialized in finding shellfish, Baltic tellins being their favorite. When they look for food, you see them slowly moving over the flats with their head bent down and the tip of their bill pushed into the mud. All of the red knots combined eat around 1.5 million kilograms of shellfish meat per year from the Dutch tidal flat bottom.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

The red knot has a more conspicuous plumage during the breeding season than in the winter months. The bill is long, thick, straight and black, and the legs are black or dull green. Throughout the winter, the upperparts are pale grey with blackish primaries and a white stripe across the wing. The head is grey, with white areas above the eye and on the throat. The breast and tail are pale grey, but the flanks, belly and undertail feathers are white. However, during the breeding season the head becomes reddish with brownish mottling on the forehead, crown and back of the neck. The underparts also become red, and the tail develops a dark grey-brown stripe. Juveniles are varying shades of grey with dark edgings on the feathers, a white stripe across the wings and dark grey primaries (2) (5). Following migration the usually plump body is considerably leaner (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

The species has an extremely large range, breeding from Alaska (U.S.A.) across the Arctic to Greenland (Denmark) and northern Russia. It winters on the Atlantic and Pacific coasts of North and South America, north-western Europe, along the west coast of Africa from Tunisia andMorocco down to South Africa, across southern Asia and aroundAustralasia (Van Gils and Wiersma 1996). There are six subspecies: C. c. canutus breeds in central and northern Siberia, the Taymyr Peninsula and possibly Yakutia, wintering in western and southern Africa and south Asia; C. c. piersmai breeds in the New Siberian Islands (Russia) and winters in north-west Australia; C. c. rogersi breeds on the Chukotskiy Peninsula and possibly further west, and winters in Australasia; C. c. roselaari breeds on Wrangel Island (off north-east Siberia) and north-west Alaska, wintering primarily in western Mexico, as well as the coast of south-east U.S.A., southern Panama and northern Venezuela; C. c. rufa breeds in the Canadian low Arctic and winters on the coasts of south Florida, Texas, northern Brazil(15,400 individuals [R. I. G. Morrison in litt. 2015]) and southern South America; C. c. islandica breeds on the islands of the Canadian high Arctic and north Greenland, it winters in western Europe (Van Gils and Wiersma 1996).

The main spring staging sites for each of the six subspecies have been identified: Schleswig Holstein Wadden Sea, Germany (C. c canutus); Troms and Finnmark, north Norway and west Iceland (C. c. islandica); Delaware Bay, U.S.A. (C. c. rufa); Bohai Bay, China (C. c. piersmai and C. c. rogersi) and the Yukon-Kuskokwim Delta, Copper River Delta and Grays Harbour/Willapa Bay, U.S.A. (C. c. roselaari) (Leyrer et al. 2014).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North America
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Nesting range in North America is in northwestern and northern Alaska, and Canadian arctic islands east to Ellesmere and south to southern Victoria and Southhampton islands, probably also on Adelaide Peninsula and Mansel Island; nesting also occurs in the northern Palearctic.

During the boreal winter, the range in the New World extends mainly from coastal regions of southern California, Gulf Coast and Massachusetts south to Tierra del Fuego; generally rare north of southern South America; major South American nonbreeding areas are Tierra del Fuego and Patagonian coast of Argentina, especially Bahia Lomas (Morrison and Ross 1989). New World red knots principally occupy two areas: about 100,000 birds along Atlantic coast of southern Argentina, about 10,000 along Florida Gulf Coast, with no evidence of interchange between the 2 groups (Harrington et al. 1988). In the Old World, most red knots are in southern Europe, southern Asia, Africa, and the Australasian region during the boreal winter.

Nonbreeders occasionally summer in the winter range.

Delaware Bay is the most important spring migration stopover in the eastern United States (Clark et al. 1993, Botton et al. 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Six subspecies of the red knot are recognised, all of which breed on the Northern tundra areas and winter at temperate or tropical coastal areas. The American subspecies (Calidris canutus rufa) has the longest migration route, breeding in the Canadianarctic and flying via the eastern American coast to Patagonia and Terra del Fuego. The other American subspecies (C. c. rooselari) breeds in Alaska and winters in Florida. The C. c. islandica subspecies breeds in Canada and Greenland and winters in Europe along the coasts of the United Kingdom, France and the Wadden Sea. C. c. canutus breeds in West-Siberia and flies via Europe to West- and South-Africa, where the mudflats of the Banc d'Arguin in Mauritania are an important wintering area. The last two subspecies both breed in eastern Siberia and migrate south via the Chinese and Korean coasts; C. c. piersmai winters in north-west Australia and C. c. rogersi winters in New Zealand (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Length: 27 cm

Weight: 148 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Length: 23-25 cm. Plumage: above grey with paler edges to feathers, below white mottled grey on flanks, breast, neck; rump and slender wing stripe whitish; breeding bird above mottled chestnut and black, below bright rufous chestnut. Bare parts: iris brown; bill heavy, short, and sometimes slightly down-curved, black; feet and legs olive, short. Habitat: seashore, mudflats. Uncommon palearctic migrant. <389><391><393>
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The species breeds in the high Arctic (del Hoyoet al.1986) on dry upland tundra including weathered sandstone ridges, upland areas with scattered willowsSalixspp.,Dryasspp. and poppy, moist marshy slopes and flats in foothills, well-drained slopes hummocked withDryasspp. (Johnsgard 1981) and upland glacial gravel close to streams or ponds (del Hoyoet al.1986).The nest is an open shallow depression (Flintet al.1984) either positioned on hummocks surrounded by mud and water or on stony or gravelly ground (Johnsgard 1981) on open vegetated tundra or stone ridges (del Hoyoet al.1986).Outside of the breeding season the species is strictly coastal, frequenting tidal mudflats or sandflats, sandy beaches of sheltered coasts, rocky shelves, bays, lagoons and harbours, occasionally also oceanic beaches and saltmarshes (del Hoyoet al.1986).

During the breeding season it feeds predominantly on insects (mainly adult and larval Diptera, Lepidoptera, Trichoptera, Coleoptera and bees) as well as spiders, small crustaceans, snails and worms (del Hoyoet al.1986). When it first arrives on the breeding grounds, however, the species is dependent upon vegetation (including the seeds of sedges, horsetailsEquisetumspp. and grass shoots) owing to the initial lack of insect prey (Johnsgard 1981).Outside of the breeding season the species takes intertidal invertebrates such as bivalve and gastropod molluscs, crustaceans (del Hoyoet al.1986) (e.g. horseshoe crabLimulusspp. eggs) (Karpantyet al.2006), annelid worms and insects, rarely also taking fish and seeds (del Hoyoet al.1986). It is a full long-distance migrant that utilises few stopover sites or staging areas (del Hoyo et al. 1986).

Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 18 specimens in 1 taxon.
Water temperature and chemistry ranges based on 14 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 9.226 - 13.104
  Nitrate (umol/L): 1.865 - 7.963
  Salinity (PPS): 32.515 - 35.399
  Oxygen (ml/l): 6.089 - 6.688
  Phosphate (umol/l): 0.256 - 0.562
  Silicate (umol/l): 1.647 - 4.330

Graphical representation

Temperature range (°C): 9.226 - 13.104

Nitrate (umol/L): 1.865 - 7.963

Salinity (PPS): 32.515 - 35.399

Oxygen (ml/l): 6.089 - 6.688

Phosphate (umol/l): 0.256 - 0.562

Silicate (umol/l): 1.647 - 4.330
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Primarily seacoasts on tidal flats and beaches, less frequently in marshes and flooded fields (AOU 1983). On sandy or pebbly beaches, especially at river mouths; feeds on mudflats, loafs and sleeps on salinas and salt-pond dikes (Costa Rica, Stiles and Skutch 1989). Nests on ground in barren or stony tundra and in well-vegetated moist tundra.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 18 specimens in 1 taxon.
Water temperature and chemistry ranges based on 14 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 9.226 - 13.104
  Nitrate (umol/L): 1.865 - 7.963
  Salinity (PPS): 32.515 - 35.399
  Oxygen (ml/l): 6.089 - 6.688
  Phosphate (umol/l): 0.256 - 0.562
  Silicate (umol/l): 1.647 - 4.330

Graphical representation

Temperature range (°C): 9.226 - 13.104

Nitrate (umol/L): 1.865 - 7.963

Salinity (PPS): 32.515 - 35.399

Oxygen (ml/l): 6.089 - 6.688

Phosphate (umol/l): 0.256 - 0.562

Silicate (umol/l): 1.647 - 4.330
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The red knot breeds on tundra. Stopover and winter areas are preferably large tidal mudflats, but include also rocky shores and beaches (2) (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Red knots migrate long distances between nesting areas in mid- and high arctic latitudes and southern nonbreeding habitats as far north as the coastal United States (low numbers) and southward to southern South America, and to southern Asia, Africa, and Australasian region. Subspecies rufa migrates from nesting areas in the central Canadian Arctic to wintering grounds at the southern tip of South America.. Subspecies islandica breeds in the northeastern Canadian High Arctic and Greenland and migrates to wintering areas in Europe. Subspecies roselaari breeds in Alaska and on Wrangel Island and is thought to comprise the population wintering in Florida and on coastlines of the Gulf of Mexico, the Caribbean, and northern South America (Piersma and Davidson 1992, Harrington 2001).

Red knots migrate in large flocks northward through the contiguous United States mainly April-June, southward July-October (Bent 1927). Arrival in breeding areas occurs in late May or early June; most have departed breeding areas by mid-August. The species is more abundant in migration along the U.S. Atlantic coast than on the Pacific coast. Knots that visit Delaware Bay in spring come mostly from South America, and these have strong fidelity to migration stopover sites; those that winter in Florida are underrepresented during migration in New Jersey and Massachusetts. Migration through Costa Rica occurs late August-October and mainly mid-March to late April (Stiles and Skutch 1989). This species typically makes long flights between stops (Hayman et al. 1986). See Piersma and Davidson (1992) for information on knot migration.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Eats mainly mollusks, eggs of crab and horseshoe crab, insects, some seeds and small fishes; pecks and snatches at sand or mud, or probes. Horseshoe crab eggs are an important source of food for north-bound migrants at Delaware Bay (Botton et al. 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Global Abundance

>1,000,000 individuals

Comments: Global population estimated to be 1,291,000 individuals (Rose and Scott 1997); North American portion is thought to be on the order of 400,000 (Morrison et al. 2001).

See also information for subspecies rufa.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Nonbreeding: usually in compact flocks.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Cyclicity

Comments: See Robert et al. (1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 25.1 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Lays clutch of usually 4 eggs, June-July. Incubation lasts about 20-25 days, by both sexes. Young are tended mostly by male (female leaves before fledging), leave nest soon after hatching, can fly at about 18 days (Terres 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Calidris canutus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 9 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTTTCTCCAACCCACAAAGACATTGGCACCCTATACCTAATCTTCGGTGCATGAGCTGGTATAGTTGGAACCGCCCTTAGCCTACTCATTCGCGCAGAACTAGGCCAACCCGGAACCCTCTTAGGAGATGACCAAATTTATAATGTAATTGTCACCGCCCACGCCTTCGTAATAATCTTCTTCATGGTAATGCCAATTATAATTGGTGGTTTCGGAAACTGACTAGTCCCCCTTATAATCGGCGCCCCCGACATAGCATTCCCTCGCATAAATAACATAAGCTTCTGACTTCTTCCCCCATCATTCCTCCTACTACTAGCATCCTCTACAGTAGAAGCTGGAGCAGGTACAGGATGAACAGTATACCCCCCACTCGCTGGTAACCTAGCCCATGCTGGAGCTTCCGTAGACCTAGCTATTTTCTCCCTCCACCTGGCAGGTGTCTCCTCTATTCTAGGTGCTATCAACTTCATCACAACTGCCATCAACATGAAGCCCCCAGCCCTATCTCAATACCAAACACCCCTATTTGTATGATCAGTACTTATTACCGCTGTTCTACTCTTACTTTCCCTTCCAGTCCTTGCCGCTGGCATTACTATACTACTAACAGACCGAAACCTAAACACTACATTCTTCGACCCAGCTGGAGGAGGAGACCCAGTCCTATACCAACACCTCTTCTGATTCTTCGGCCACCCAGAAGTCTACATTCTAATCCTACCAGGATTTGGAAT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Calidris canutus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 27
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2015

Assessor/s
BirdLife International

Reviewer/s
Symes, A.

Contributor/s
Meltofte, H., Morrison, R., Nagy, S., Stroud, D., Wilson, J., Zckler, C., van Roomen, M. & Balachandran, S.

Justification
This species has been uplisted to Near Threatened as it almost meets the requirements for listing as threatened under criteria A2abc+3bc+4abc. It has an extremely large range and six subpopulations across which trends are variable. The population trend of the largest subpopulation, islandica, is unclear as is the trend of roselaari. The rufa and canutussubpopulations have both experienced population declines. Two subpopulations use the East Asian-Australasian Flyway and have experienced significant declines owing to loss of habitat in the Yellow Sea. Should new research resolve uncertainties in the trends of several of these subpopulations the species may warrant uplisting or downlisting.

History
  • 2012
    Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5