Articles on this page are available in 1 other language: Chinese (Simplified) (6) (learn more)

Overview

Distribution

Range Description

This species breeds in northern and north-eastern Russia and sporadically in western and northern Alaska (U.S.A.). It winters from eastern India, Myanmar, southern China and Taiwan (China) to the Philippines, Indonesia, the Solomon Islands, Australia and New Zealand (Van Gils et al. 2013).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (200,000 to >2,500,000 square km (about 80,000 to >1,000,000 square miles)) BREEDING: northern and western Alaska (Point Barrow and Seward Peninsula, possibly elsewhere) and northeastern Siberia. NON-BREEDING: from southern China south to Andaman and Nicobar Islands, East Indies, New Guinea, Bismarck and Solomon Islands, Australia, Tasmania, and New Zealand. MIGRATION: coastal northern Alaska, through Pribilofs and Aleutians, widely in coastal western and south-coastal Alaska, casually southward to California (AOU 1983). Accidental in Hawaii and northeastern U.S.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Breeds Siberia and Alaska; disperses to s Asia and Australasia.
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Length: 15 cm

Weight: 36 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Length: 13-16 cm. Plumage: above grey; below white with partial grey band on chest; white superciliary line; transitional dress above dark with paler edges to feathers; wing-coverts grey, throat, foreneck and breast washed pale rufous becoming bright rufous in breeding birds. Immature like adult but brighter above. Bare parts: iris dark brown; bill black; feet and legs black, toes long. Habitat: tidal lagoons, mudflats, saltpans. Rare palearctic migrant. <389><391><393>
  • Urban, E.K., C.H. Fry & S. Keith (1986). The Birds of Africa, Volume II. Academic Press, London.
translation missing: en.license_cc_by_4_0

© WoRMS Editorial Board

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

Length: 13-16 cm. Plumage: above grey; below white with partial grey band on chest; white superciliary line; transitional dress above dark with paler edges to feathers; wing-coverts grey, throat, foreneck and breast washed pale rufous becoming bright rufous in breeding birds. Immature like adult but brighter above. Bare parts: iris dark brown; bill black; feet and legs black, toes long. Habitat: tidal lagoons, mudflats, saltpans. Rare palearctic migrant. <389><391><393>
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
During the breeding season the species uses low altitude montane tundra in the subalpine belt. In the non-breeding season it mainly uses coastal and intertidal mudflats, sheltered inlets, bays and lagoons but it also uses freshwater, brackish and saltwater wetlands and occasionally sandy beaches and rocky shorelines (Van Gils et al. 2013).

Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: NON-BREEDING: tidal mudflats and beaches; migrant flocks may pause in open areas such as antenna fields and airstrips (AOU 1983, Pratt et al. 1987). BREEDING: Swampy or mossy tundra, especially with scattered willow scrub (AOU 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Global Abundance

>1,000,000 individuals

Comments: Total population estimated to be 471,000 (Morrison et al. 2001). Listed as "by far the most common stint" on Asian and Australian wintering grounds by Paulson (1993). A few dozen breed in Alaska (Morrison et al. 2001).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Calidris ruficollis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CCTATACCTAATCTTCGGTGCATGAGCTGGTATAGTCGGAACCGCCCTCAGCCTGCTCATCCGTGCAGAACTAGGCCAGCCCGGAACCCTTCTAGGAGATGACCAAATCTATAACGTCATTGTCACCGCCCATGCCTTCGTAATAATCTTCTTCATAGTAATGCCAATCATAATTGGTGGCTTCGGAAATTGACTAGTTCCACTTATAATTGGTGCCCCTGACATAGCATTCCCTCGCATGAACAACATAAGCTTTTGATTACTACCTCCATCATTCCTACTGCTTCTAGCATCATCTACAGTAGAAGCCGGAGCAGGTACAGGATGGACAGTATACCCCCCACTTGCTGGCAACTTAGCCCATGCCGGAGCTTCTGTAGACCTAGCTATCTTCTCCCTCCACCTAGCAGGTGTCTCTTCTATTCTAGGTGCTATTAACTTCATCACAACTGCCATTAATATAAAACCCCCAGCCCTCTCCCAATACCAAACACCCCTATTTGTATGATCAGTACTTATCACCGCCGTCCTACTTCTACTTTCTCTCCCAGTTCTCGCTGCTGGTATCACCATACTATTAACAGATCGAAATCTAAACACCACATTCTTTGACCCCGCTGGAGGCGGAGACCCAGTCCTATACCAACACCTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Calidris ruficollis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 12
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2015

Assessor/s
BirdLife International

Reviewer/s
Symes, A.

Contributor/s
Balachandran, S.

Justification
This species is classified as Near Threatened. It is restricted to the East Asian-Australasian flyway where loss of key stopover sites in the Yellow Sea region are thought to be responsible for declines in waterbird populations. The species is thought to be declining at a rate approaching the threshold for Vulnerable under the population size reduction criterion, according to thirty years of monitoring data from around Australia and New Zealand (almost meets A2bc+3bc+4bc).

History
  • 2012
    Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5