Articles on this page are available in 1 other language: Dutch (2) (learn more)

Overview

Brief Summary

The great black-backed gull is largest species of gulls in the world. With its wing span of 170 centimeters and their enormous beak, they look very impressive. They also make a much lower and raspier sound than the other gulls. In 1993, they nested in the Netherlands for the first time. Since then, there have been a number of nesting pairs every year. Greater black-backed gulls eat fish, shellfish and other molluscs, worms and insects. They will also hunt other birds, such as the manx shearwater, little auks and puffins. Due to their size, they easily steal food from other birds.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species can be found breeding on coasts from the extreme north-west of Russia, along Scandinavia, on Baltic Sea coasts, on the coasts of north-western France, the United Kingdom and Ireland, across the north Atlantic in Iceland and southern Greenland and on the Atlantic coasts of Canada and the USA down to North Carolina. Individuals breeding in harsher environments will migrate south, wintering on northern coasts of Europe from the Baltic Sea to southern Portugal, and down North America as far south as the Carribean (del Hoyo et al. 1996).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Caribbean; North America; mainly coasts of North Atlantic, wintering to mid-Atlantic states and Great Lakes
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: BREEDING: northern Quebec and northern Labrador south to St. Lawrence River, Anticosti Island, and along coast to North Carolina (Clapp and Buckley 1984), also in southern Ontario on Lake Huron, and in Palaearctic. NON-BREEDING: in North America, along Atlantic coast from Newfoundland to North Carolina, less commonly to Florida and Great Lakes.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Palearctic and ne N Am.; winters to W Indies and Iberian Pen..
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Northern North America south to Florida on Atlantic coast. Europe, Scandinavia, and Russia south to France and Mediterranean.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Length: 76 cm

Weight: 1829 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Length: 71-79 cm, Wingspan: 152-167 cm
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Behaviour The migratory movements of this species vary throughout its range, with high Arctic breeders migrating south for the winter but southern breeders only dispersing short distances (del Hoyo et al. 1996). The breeding season starts from early-April or mid-May with the species nesting in solitary pairs amidst colonies of other species or in small mixed-species colonies (del Hoyo et al. 1996) of up to 50-100 individuals (Richards 1990) (e.g. with Herring Gull Larus argentatus) (del Hoyo et al. 1996) in favourable locations (Richards 1990). The autumn migration occurs between July and November (peaking October-November) and the return migration to the breeding grounds occurs between March and April (Olsen and Larsson 2003). Outside of the breeding season the species is largely gregarious (Olsen and Larsson 2003). Habitat The species inhabits rocky or sandy coasts, estuaries and inshore and offshore waters, breeding on vegetated islands, dunes, flat-topped stacks, rocky shores (del Hoyo et al. 1996), flat beaches (Snow and Perrins 1998) and islands in saltmarsh (del Hoyo et al. 1996). The species may also breed on undisturbed inland sites including islets in large freshwater lakes and rivers (Snow and Perrins 1998), fields and open moorland (del Hoyo et al. 1996). Diet The species is omnivorous and opportunistic, its diet consisting of fish, adult and young birds, birds eggs, mammals (e.g. rabbits, lemmings, rats and mice), insects, marine invertebrates (e.g. molluscs), carrion and refuse (del Hoyo et al. 1996). Breeding site The nest is a shallow cup constructed from grass, moss and seaweed and is positioned on sand, grass or bare rock substrates on vegetated islands, rocky ridges and outcrops, dunes (del Hoyo et al. 1996), flat beaches (Snow and Perrins 1998) and islands in saltmarsh among scrub (del Hoyo et al. 1996). The species may also nest in undisturbed inland sites such as islets in large freshwater lakes and rivers (Snow and Perrins 1998), fields and open moorland (del Hoyo et al. 1996). Management information The breeding densities of this species in the Baltic Sea were unaffected by the removal of the introduced nest predator American mink Neovison vison from small offshore breeding islands (Nordstrom et al. 2003). The species is considered to be a threat to other bird species due to its predatory and opportunistic diet (del Hoyo et al. 1996).

Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 48442 specimens in 1 taxon.
Water temperature and chemistry ranges based on 26339 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): -0.189 - 25.827
  Nitrate (umol/L): 0.156 - 16.868
  Salinity (PPS): 5.715 - 36.728
  Oxygen (ml/l): 4.687 - 8.415
  Phosphate (umol/l): 0.037 - 1.130
  Silicate (umol/l): 0.565 - 11.419

Graphical representation

Temperature range (°C): -0.189 - 25.827

Nitrate (umol/L): 0.156 - 16.868

Salinity (PPS): 5.715 - 36.728

Oxygen (ml/l): 4.687 - 8.415

Phosphate (umol/l): 0.037 - 1.130

Silicate (umol/l): 0.565 - 11.419
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: ALL SEASONS: Primarily seacoasts, less commonly on large inland bodies of water (AOU 1983). BREEDING: Nests on ground or on rocks on rocky coasts and islands, occasionally on inland lakes. Along western North Atlantic coast, typically nests on small low islands, either rocky, grassy, or sandy with relatively little tall vegetation. On large islands, may nest on rocky peninsula, among boulders, or in low vegetation back from shore. Uses dredge-spoil islands. Usually nested under IVA FRUTESCENS in New Jersey salt marshes. Will nest with other gulls and cormorants (Spendelow and Patton 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 48442 specimens in 1 taxon.
Water temperature and chemistry ranges based on 26339 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): -0.189 - 25.827
  Nitrate (umol/L): 0.156 - 16.868
  Salinity (PPS): 5.715 - 36.728
  Oxygen (ml/l): 4.687 - 8.415
  Phosphate (umol/l): 0.037 - 1.130
  Silicate (umol/l): 0.565 - 11.419

Graphical representation

Temperature range (°C): -0.189 - 25.827

Nitrate (umol/L): 0.156 - 16.868

Salinity (PPS): 5.715 - 36.728

Oxygen (ml/l): 4.687 - 8.415

Phosphate (umol/l): 0.037 - 1.130

Silicate (umol/l): 0.565 - 11.419
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Coastal waters and offshore.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Most populations are year-round residents.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Eats carrion, fishes taken from other gulls, eggs and young of other birds, invertebrates, garbage, and other animal matter.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Carrion, fish, mollusks, crustaceans, marine worms, insects, rodents, berries, birds, eggs, and hatchlings.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Known prey organisms

Larus marinus (Larus marinus great black-backed gull) preys on:
Sprattus sprattus
Clupea harengus
Platichthys flesus
Crangon crangon
Mytilus edulis
Cerastoderma edule

Based on studies in:
Scotland (Estuarine)

This list may not be complete but is based on published studies.
  • Hall SJ, Raffaelli D (1991) Food-web patterns: lessons from a species-rich web. J Anim Ecol 60:823–842
  • Huxham M, Beany S, Raffaelli D (1996) Do parasites reduce the chances of triangulation in a real food web? Oikos 76:284–300
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Larus marinus (Larus marinus great black-backed gull) is prey of:
Cryptocotyle lingua
Renicola roscorita

Based on studies in:
Scotland (Estuarine)

This list may not be complete but is based on published studies.
  • Huxham M, Beany S, Raffaelli D (1996) Do parasites reduce the chances of triangulation in a real food web? Oikos 76:284–300
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 27.1 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Lays clutch of 2-3 (usually 3) eggs, May-June in North Amer. Incubation 26-30 days, by both sexes. Young tended by both parents, fly at 6-8 weeks. Usually nests solitarily or in small (sometimes large) colonies (Terres 1980); largest reported colony: 6500 birds on Monomoy Island, Massachusetts, 1981; in 1970s, none of colonies from New Jersey south had more than 50 birds (Spendelow and Patton 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

First breeds at 4-5 years old. Nests in colonies, often with other gull species. Sometimes nests as isolated pairs. Nest is built by both sexes, on the ground near rocks. 2-3 eggs, incubated by both sexes for 27-28 days. Young are fed and cared for by both parents. First capable of flight at 7-8 weeks old.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Larus marinus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCACAAAGACATTGGCACCCTATACTTAATCTTTGGCGCATGAGCTGGCATAGTAGGTACTGCCCTCAGCCTGCTTATCCGTGCAGAACTTGGCCAACCCGGAACCCTCCTAGGAGACGACCAAATCTATAACGTAATTGTCACCGCCCATGCCTTCGTGATAATCTTCTTCATAGTGATACCAATCATGATCGGTGGGTTTGGAAACTGACTAGTCCCACTTATAATCGGTGCCCCTGATATAGCATTTCCACGCATAAACAACATAAGCTTCTGACTATTACCCCCATCATTCCTACTCCTCCTAGCCTCTTCCACAGTAGAAGCTGGAGCCGGCACAGGATGAACAGTATACCCCCCTCTAGCTGGCAATCTAGCCCATGCTGGAGCCTCAGTAGACCTAGCAATCTTCTCTCTTCACTTAGCAGGTGTATCTTCCATTCTGGGTGCTATCAACTTTATCACTACAGCCATCAACATAAAACCCCCTGCCCTCTCACAATATCAAACCCCACTATTCGTATGATCCGTACTCATCACTGCCGTCCTATTACTACTTTCACTCCCAGTGCTTGCCGCAGGCATTACTATGCTACTCACAGACCGAAACCTAAACACAACATTCTTCGATCCCGCCGGAGGCGGCGACCCTGTACTGTACCAACACCTCTTCTGATTCTTCGGCCACCCAGAAGTATACATCCTAATCCTACCAGGATTTGGAATTATCTCCCACGTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Larus marinus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 13
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5