Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Brief Summary

Biology

The macaroni penguin is mainly active during the day. Very little is known of the species outside of the breeding season; most studies have been carried out on breeding birds. They feed mainly on krill (shrimp-like crustaceans), although in some areas, fish become an increasingly important food source as the breeding season progresses (5). It has been estimated that macaroni penguins alone consume four million tonnes of krill each year (6). In some populations, dives typically take the form of a V-shape, reaching depths of 48 m (4), although in other populations, the dive profiles were more complex (5). Birds return to the breeding colonies each year in October and November, with males arriving before the females (4). Individuals often have to walk hundreds of meters over screes to reach their nest site (2). Macaroni penguins are monogamous and pair-bonds are long-lasting. Each year the pair reunites at the same nest location, recognising each other by means of their calls (4). Pairs often perform a display known as the 'ecstatic display' in which their heads are swung from side to side (4). The nest is a simple scrape in the ground, typically lined with small rocks. In some cases, it may be made on a patch of grass and lined with grass shoots (4). Two eggs are laid; the second egg is always larger than the first and is usually the only successful egg per nest. If both eggs are lost, the pair is unable to produce a replacement brood (3). Incubation takes up to 37 days and is shared by the parents in three main shifts. The first shift lasts for 8 - 12 days and is shared by the male and female. The second shift (12 - 14 days) is carried out by the female and the final shift (9 - 11 days) by the male. During each shift, the non-incubating bird goes to forage at sea during the day (4) (2). The newly hatched chicks are helpless, and for the first 23 - 25 days they are guarded and brooded by the male, while the female forages and feeds the chicks each day by regurgitating food (4). After this period, the chicks have developed their first plumage, which allows them to maintain their own temperature and so they can leave the nest. They cluster into small crèches for protection; at this stage, both parents are able to forage (3). Most chicks will have fledged at 60 - 70 days of age (4), at which point they have developed waterproof plumage (3). They do not start to breed until five years of age in females and six in males (4). After the chicks leave the breeding colonies, the adults feed at sea for around three weeks before their annual moult. During the moult they are unable to forage, as their plumage is not watertight. After the 25-day moult the adults leave the colonies to spend the winter at sea (3). In undisturbed colonies, predation is relatively low. Eggs (mainly deserted ones) are predated upon by skuas, sheathbills, and kelp gulls while weakened chicks, or those separated from the crèche are taken by skuas and giant petrels. Whilst at sea, adult macaroni penguins are predated upon by leopard seals and Antarctic fur seals (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

This large, crested penguin is similar in appearance to other members of the genus Eudyptes; the macaroni penguin is, however, larger than all other species except the royal penguin (E. schlegeli) (4). Adult macaroni penguins have golden-yellow plume-like feathers that arise from a central patch on the forehead, extending back along the crown and drooping down behind the eye (4) (2). The head, chin, throat and upperparts are black; the underparts are white and the flippers are black on the uppersurface but mainly white below (4). The large bill is orange-brown; the eyes are red and there is a patch of bare pink skin from the base of the bill to the eye. The legs and feet are pink. Males and females are similar in appearance, but males tend to be slightly larger (4). Immature birds lack the head plumes or have a few sparse yellow feathers on the forehead; their bills are smaller than those of adults and are brownish-black in colour; the chin and throat are dark grey (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Eudyptes chrysolophus breeds in at least258 colonies at c.55 breeding sites (Crossinet al.2013), including southern Chile, the Falkland Islands (Malvinas), South Georgia (Georgia del Sur) and the South Sandwich Islands (Islas Sandwich del Sur), the South Orkney and South Shetland Islands, Bouvet Island (to Norway), Prince Edward and Marion Islands (South Africa), Crozet Islands, Kerguelen Islands (French Southern Territories), Heard and McDonald Islands (to Australia) and very locally on the Antarctic Peninsula. The global population is estimated at 6.3 million breeding pairs, with key populations on Isles Crozet (2,200,000 pairs, including 1 million on Ilots des Pingouins), Kerguelen (1.8 million pairs), Heard Island (1 million pairs), South Georgia (1 million pairs) and Marion Island (290,000 pairs).

Previously, the global population had been estimated at c.9 million pairs (Woehler 1993, Ellis et al. 1998). The South Georgia and Bouvet populations probably increased substantially in the 1960s and early 1970s, but have subsequently decreased. At South Georgia, c.5 million pairs were estimated in the 1980s, falling to c.2.7 million pairs in the mid 1990s and to <1 million pairs in 2002 (Crossin et al. 2013). Volcanic activity eliminated a colony of c.1 million pairs on McDonald Island, although satellite images show unidentified penguins that may be recolonising individuals of this species (Crossin et al. 2013). Surveys on Heard Island (c.1 million pairs) suggest a decrease owing to losses in some smaller colonies. The population at Marion has decreased by over 30% from 434,000 pairs in 1994-1995 to 290,000 pairs in 2008-2009 (Crawford et al. 2009), and 267,000 pairs in 2012-2013 (Dyer and Crawford in press). However, populations on Kerguelen increased by c.1% per annum between 1962 and 1985, and subsequent data from 1998 indicated that colonies were stable or increasing (H. Weimerskirch per T. Micol in litt. 1999). Populations in South America may be stable but data are few.

Satellite tracking of individuals during winter revealed that individuals from Kerguelen spent most of their time in a previously unrecognised foraging area, i.e. a narrow latitudinal band (47-49 degrees S) within the central Indian Ocean (70-110 degrees E), corresponding oceanographically to the Polar Frontal Zone (Bost et al. 2009).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The macaroni penguin is found on the edge of Antarctica and Sub-Antarctic islands south of the Americas and Africa. Large populations of this penguin can also be found in Chile, the Falkland Islands, South Georgia and the South Sandwich Islands, South Shetland Islands, Crozet Islands, Kerguelen Islands, and McDonald Islands.

Biogeographic Regions: neotropical (Native ); antarctica (Native )

  • Stonehouse, B. 1975. The Biology of Penguins. London: The MacMillan Press LTD..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Subantarctic islands in s Atlantic Ocean and s Indian Ocean.
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

The macaroni penguin has a circumpolar range (4). It breeds at 50 known sites on sub-Antarctic islands in the South Atlantic and southern Indian Oceans, with one breeding site on the Antarctic Peninsula (2) (4). Main breeding populations are located on the islands of Crozet, Heard, McDonald, Keruguelen and South Georgia (2). In 12 years, study populations on South Georgia have decreased by 65% and it is thought that the overall population on South Georgia has declined by 50% in the last 20 years (2). Most of the world population of this penguin has declined by at least 20% in the last 36 years (equivalent to three generations), but surveys are required to confirm the status of the species (2). The range of the macaroni penguin outside of the breeding season is unknown, although it is thought that it stays in Antarctic waters (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

The Macaroni penguin is a medium-sized bird that stands about 71 centimeters tall and weighs between 5 to 6 kg. Females are usually smaller than males. Males and females are monomorphic. They have orange, yellow, and black crests that join on the top of the head. This penguin has a red bill, and the chin, face and under the throat have solid black feathers.

Range mass: 5000 to 6000 g.

Average wingspan: 71 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It nests on level to steep ground, often walking hundreds of metres across steep screes to nest-sites. Breeding areas usually have little or no vegetation due to erosion by birds. It feeds mainly on small krill (Marchant and Higgins 1990), although individuals from the Kerguelen Islands foraging in the Indian Ocean during winter do not feed on krill, taking other crustaceans instead (Bost et al. 2009).


Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 19027 specimens in 2 taxa.
Water temperature and chemistry ranges based on 18972 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): -1.348 - 9.431
  Nitrate (umol/L): 9.487 - 27.676
  Salinity (PPS): 33.189 - 34.140
  Oxygen (ml/l): 6.384 - 8.152
  Phosphate (umol/l): 0.938 - 1.987
  Silicate (umol/l): 1.978 - 89.471

Graphical representation

Temperature range (°C): -1.348 - 9.431

Nitrate (umol/L): 9.487 - 27.676

Salinity (PPS): 33.189 - 34.140

Oxygen (ml/l): 6.384 - 8.152

Phosphate (umol/l): 0.938 - 1.987

Silicate (umol/l): 1.978 - 89.471
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Macaroni penguins live in Antarctica in rocky, water-bound areas, on rocks and cliffs above the ocean.

Habitat Regions: polar ; terrestrial

Terrestrial Biomes: icecap

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 19027 specimens in 2 taxa.
Water temperature and chemistry ranges based on 18972 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): -1.348 - 9.431
  Nitrate (umol/L): 9.487 - 27.676
  Salinity (PPS): 33.189 - 34.140
  Oxygen (ml/l): 6.384 - 8.152
  Phosphate (umol/l): 0.938 - 1.987
  Silicate (umol/l): 1.978 - 89.471

Graphical representation

Temperature range (°C): -1.348 - 9.431

Nitrate (umol/L): 9.487 - 27.676

Salinity (PPS): 33.189 - 34.140

Oxygen (ml/l): 6.384 - 8.152

Phosphate (umol/l): 0.938 - 1.987

Silicate (umol/l): 1.978 - 89.471
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Breeding colonies are situated on rocky slopes or level ground, usually in areas lacking vegetation, although some nests are located amongst tussock grass (4). Little is known of this species outside of the breeding season, but it is believed that it is pelagic, spending all of its time at sea (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Macaroni penguins live almost entirely on krill (Euphasiidae) supplemented with up to five percent squid. They also eat some fish and amphipod crustaceans (Amphipoda). Recently it was discovered that some populations travel long distances to feed on populations of subantarctic krill and the crustacean, Parathemisto gauchidaudii, in the Indian ocean. Macaroni penguins fast for up to forty days during the breeding season.

Animal Foods: fish; aquatic crustaceans

Primary Diet: carnivore (Eats non-insect arthropods)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Primary predators of macaroni penguins in the water are killer whales (Orca orcinus) and leopard seals (Hydrurga leptonyx). In colonies, skuas (Stercorariidae) prey on macaroni penguin nestlings and other weak individuals. As are most penguins, macaroni penguins are counter-shaded in the water, making them difficult to see. They use their agile swimming abilities, vision, and association with other macaroni penguins to be vigilant to predators and avoid capture in the water.

Known Predators:

  • killer whales (Orca orcinus)
  • leopard seals (Hydrurga leptonyx)
  • skuas (Stercorariidae)

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Breeding Category

Breeding
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Although very near-sighted on land, penguins have exceptional vision in the water. Their eyes, like the many sea animals, are attuned to the colors of the sea. This excellent vision is needed to avoid predation by leopard seals and killer whales, which are their primary predators in the ocean. On land their main predator is the skua (a large bird) which snatches penguin's chicks from nests. The penguin communicates by complex ritual behaviors such as head and flipper waving, calling, bowing, gesturing and preening. Courtship and mating rituals include so called "ecstatic displays" where a bird, typically an unattached male, pumps his chest several times with his head stretched upwards and with flippers stretched outwards, projects a harsh loud braying sound. This can result in a mass trumpeting by other males, which is believed to help synchronize the breeding cycle.

Communication Channels: visual ; acoustic

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Macaroni penguins usually breed in the sub-Atlantic. Adults arrive to breed late in October, laying their eggs in early November. Macaroni penguin nests are made from scrapes found in mud or gravel among rocks. Macaroni penguins may assemble by the millions in their massive rookeries and can be smelled as far as 5-6 miles offshore. Macaroni penguins are atypical in that the first egg of the breeding season is much smaller and less likely to develop than the second egg. Two eggs are laid with only one chick usually being reared. Incubation is shared by both parents in long shifts. Eggs hatch after 33 to 37 days. The male broods and guards the chicks for 23 to 25 days while the females bring food daily. Chicks then gather into small creches and are fed every 1 to 2 days until they are ready to leave and go to sea (60 to 70 days old). Macaroni penguins leave their breeding colony by April or May.

Breeding interval: Macaroni penguins breed once yearly.

Breeding season: Adults arrive to breed late in October, laying their eggs in early November.

Average eggs per season: 2.

Range time to hatching: 33 to 37 days.

Range time to independence: 60 to 70 days.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

  • Ainley, D., R. LeResche, W. Sladen. 1983. Breeding Biology of the Adélie Penguin. London, England: University of California Press,Ltd..
  • Stonehouse, B. 1975. The Biology of Penguins. London: The MacMillan Press LTD..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Eudyptes chrysolophus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TATCGGCACCCTCTACCTAATCTTCGGTGCATGAGCAGGCATAGCCGGAACTGCCCTTAGCCTACTCATCCGTGCAGAGCTCGGCCAACCTGGAACTCTCCTAGGAGACGACCAAATCTACAACGTAATCGTCACCGCCCATGCTTTCGTAATAATCTTCTTCATAGTAATACCCATTATGATCGGAGGATTCGGAAACTGACTAGTCCCCCTTATAATTGGCGCCCCCGACATAGCATTCCCCCGCATGAATAACATAAGCTTCTGACTACTCCCCCCTTCCTTCCTACTCCTACTAGCCTCCTCCACAGTAGAGGCAGGAGCTGGCACAGGATGAACTGTATACCCACCACTAGCGGGCAACCTAGCCCATGCCGGGGCATCTGTAGACTTAGCCATTTTCTCACTCCACCTAGCAGGAGTCTCCTCCATTCTTGGAGCAATTAACTTCATCACCACCGCCATCAACATAAAACCCCCAGCCCTCTCACAGTACCAAACCCCTCTATTCGTATGGTCCGTTCTTATCACAGCCGTCCTCCTACTACTCTCACTCCCCGTACTCGCTGCAGGCATCACCATGCTACTAACAGACCGAAACTTAAACACCACCTTCTTTGACCCTGCCGGAGGAGGTGACCCAATCCTATACCAGCACCTCTTTTGATTCTTCGGCCACCCAGAAGTCTATATCCTAATTCTACCAGGCTTCGGAATCATCTCTCATGTAGTAACATATTACGCAGGCAAAAAGGAACCCTTCGGCTACATAGGAATAGTATGAGCCATATTATCCATCGGATTCCTCGGCTTCATCGTATGAGCCCATCACATATTCACAGTCGGAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Eudyptes chrysolophus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A2bce+3bce+4bce

Version
3.1

Year Assessed
2013

Assessor/s
BirdLife International

Reviewer/s
Butchart, S.

Contributor/s
Crawford, R., Croxall, J., Micol, T., Nisbet, I. & Weimerskirsch, H.

Justification
This species qualifies as Vulnerable because the global population appears to have declined rapidly over the last three generations (36 years). The primary drivers of declines are uncertain but could include climatic variation and competition for food from commercial fisheries.


History
  • 2012
    Vulnerable (VU)
  • Vulnerable (VU)
  • Vulnerable (VU)
  • Vulnerable (VU)
  • Vulnerable (VU)
  • Vulnerable (VU)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)