Overview

Brief Summary

Biology

After spending much of the year alone in the open ocean, males arrive at the chosen breeding site ahead of the females during late June or July. Two weeks later the females arrive and mating takes place. The birds are monogamous and prefer their nest sites to be hidden from one another. Two pale-green eggs are laid in a cavity between tree roots, stones or small burrows in the coastal forest, and incubation takes from four to six weeks. The birds do not attempt to collect nest materials. Although it is usual for just one egg to hatch successfully, occasionally both chicks emerge. However, the parents rarely catch enough food for two offspring and the smaller chick usually dies (3). While the chick is still defenceless, one parent (usually the male), will guard it whilst the other finds food. Fiordland crested penguins feed inshore and catch crustaceans, squid and small fish which they regurgitate for the chick. Once the young is large enough to be safe from most native predators, both parents take on the role of fishing to provide their offspring with food. Chicks often wander about the nest site or gather in loose-knit crèches. After about 10 or 11 weeks, the chick moults and leaves the nest site, finally adopting the solitary pelagic lifestyle of the adult birds. It will return to breed at the age of five years (2) (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

One of the smaller members of the penguin family, the Fiordland crested penguin has a black head, throat and back, a white front and underside, a thick stubby orange bill and pink feet. The most distinguishing features are the yellow sulphur-coloured crests above the eyes that extend from the bill to just behind the head. Both sexes are similar, whereas young birds have paler cheeks and shorter crests (2) (4). Like other members of the genus Eudyptes the Fiordland crested penguin has a black throat but can be distinguished from the similar Rockhopper, Macaroni and Royal penguins by the shape, extent and colour of the eye crests (4). The two species that can be confused with the Fiordland crested are the erect-crested penguin and the Snares Island penguin. The former has eye crests that stand proud of the top of the head and no part which extends to below the eye itself. The latter is a slightly larger bird with a thicker bill (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Eudyptes pachyrhynchus nests on Stewart Island and several of its offshore islands, Solander Island and on the west to south-west coast of the South Island, New Zealand. The population is estimated at 2,500-3,000 breeding pairs, mostly nesting on predator-free islands, and divided into 12 major, fragmented breeding sites with c.100 nests or more (McLean et al. 1997). Numbers appear to be declining in some populations, principally those on the mainland where predators have the greatest impact. At Open Bay Island, there was a decline of 33% between 1988 and 1995 (Ellis et al. 1998), and at Dusky Sound there were "thousands" of birds in 1900 but only a few hundred in the 1990s (Russ et al. 1992). Non-breeding dispersal patterns at sea are largely unknown.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Fiordland Penguins Eudyptes pachyrhynchus are found from the southwestern coast of the South Island of New Zealand, to the nearby islands of Stewart and Solander.

(Stonehouse 1975; Simpson 1976)

Biogeographic Regions: australian (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

South I. (New Zealand) and adjacent subantarctic islands.
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Historic Range:


Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

A migratory species, found in Antarctic waters and around the southern circumpolar islands, the Fiordland penguin breeds on the coast of southwest New Zealand, Stewart Island and Solander Island (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

The Fiordland Penguin, also known as the thick-billed penguin, has an average length of 55cm (21 in). The head and body of this penguin are black, with the exception of its white front and the white markings on its cheeks. Fiordland Penguins have a crest of brilliant yellow feathers which are visible at the base of the bill and extend over the eye. Fiordland Penguins are monomorphic, that is the male and female look alike. Fiordland Penguin chicks have gray-brown backs with white fronts.

(Barham 2000; Stonehouse 1975; Lynch 1997)

Range mass: 2000 to 5000 g.

Other Physical Features: endothermic ; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It breeds in loose colonies along stretches of coastline in habitats ranging from mature temperate rainforest and dense scrub, to coastal caves and rocky shorelines. Penguins arrive at their breeding sites from mid-June onwards, with most nests established by mid-July. Two eggs are laid, which are incubated by both parents and hatch after 33 days (Warham 1974). Chicks fledge around mid- to late November. The diet is poorly known, but is thought to include fish, squid, octopus and krill (Heather and Robertson 1997).


Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Fiordland penguins have a pelagic aquatic habitat (open ocean). They will spend up to 75% of their lives in the ocean during the winter, as a result barnacles often attach themselves to the penguins tail. The other 25% of the Fiordlands life is spent on secluded land areas during the breeding season.

(Lynch 1997; Sparks and Soper 1987)

Terrestrial Biomes: forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Outside the breeding season, Fiordland crested penguins are birds of the open ocean. When ashore to breed they prefer secluded coastlines and chose nesting sites that are amongst rocks or have tree cover (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Fiordland Penguins feed in coastal waters, particularly during the breeding season. Fiordlands have a diet consisting of crustaceans, small fish, and squid. (Barham 2000; Sparks and Soper 1987)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

The Fiordland Penguin typically locates its breeding site inland from the coast (distances vary), with some nest sites at areas up to 100m above sea level. Nesting in loose colonies, Fiordlands locate their nests seperate and out of sight from one another. Unlike most crested penguins, the Fiordland Penguin does not nest in the open. Fiordland nests can be located in caves, under logs, at the base of trees, and under bushes (particularly away from sand flies).

Fiordland males return to the nesting sites in July, two weeks before the females. Shortly after the females arrive they mate. Soon after, the female Fiordland will lay two pale-green eggs, which incubate for 4-6 weeks. It is unusual for both of the eggs to hatch, but when they do, the parents are unable to gather enough food for both chicks. The result is the death of the smaller sibling. For the first 2-3 weeks of the chicks life, the male will stay and guard the nest while the female retrieves and regurgitates food for her young. In a couple of weeks both parents will search for food while leaving the chicks either alone or in loose creches (breeding groups). At about 75 days old, the Fiordland chicks will moult, and go to sea.

(Simpson 1976; Barham 2000)

Key Reproductive Features: iteroparous ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Eudyptes pachyrhynchus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACCTTCATTAACCGATGACTATTCTCCACCAACCACAAAGATATCGGCACCCTTTACCTAATCTTCGGTGCATGAGCAGGCATAGCCGGAACTGCCCTCAGCCTACTCATCCGCGCAGAGCTCGGTCAACCCGGAACTCTTCTAGGTGACGACCAAATCTACAACGTAATCGTCACCGCCCATGCTTTCGTAATAATCTTCTTCATAGTAATACCCATTATGATCGGAGGATTCGGAAATTGATTAGTCCCCCTTATAATTGGCGCCCCCGACATAGCATTCCCCCGCATGAATAACATAAGCTTCTGACTACTCCCCCCTTCCTTCCTACTCCTACTAGCCTCCTCCACAGTAGAAGCAGGAGCTGGCACAGGATGGACTGTATATCCACCACTAGCGGGCAACCTAGCCCATGCCGGAGCATCCGTAGACTTAGCCATCTTCTCACTCCACCTAGCAGGAGTCTCCTCCATTCTGGGAGCAATTAACTTCATCACCACCGCCATCAACATAAAACCCCCAGCCCTCTCACAGTACCAAACCCCTCTATTCGTATGGTCCGTTCTTATCACAGCCGTCCTCCTACTACTCTCACTCCCCGTACTCGCTGCAGGCATCACCATGCTACTAACAGACCGAAACTTAAACACCACCTTCTTTGATCCCGCCGGAGGAGGTGACCCAATCCTATACCAGCACCTCTTTTGATTCTTCGGCCACCCAGAAGTCTATATCCTAATTCTACCAGGCTTCGGAATCATCTCTCATGTAGTAACATACTATACAGGCAAAAAAGAACCCTTCGGCTACATAGGAATAGTATGAGCCATACTATCCATCGGATTCCTCGGCTTCATCGTATGAGC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Eudyptes pachyrhynchus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 13
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A2be+3bce+4bce;C1+2a(i)

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s
Taylor, G.A.

Justification
This species qualifies as Vulnerable because it has a small population which is estimated to have undergone a continuing rapid reduction over the last three generations, based on trend data from a few sites and a variety of threats, especially introduced predators, and this negative trend is projected to continue.


History
  • Vulnerable (VU)
  • Vulnerable (VU)
  • Vulnerable (VU)
  • Vulnerable (VU)
  • Vulnerable (VU)
  • Vulnerable (VU)
  • Vulnerable (VU)
  • Near Threatened (NT)