Overview

Brief Summary

Biology

The Royal penguins' breeding season extends from September to March and starts with the male birds coming ashore on Macquarie Island to build their nests, which are lined with grass and stones (5). The females arrive a couple of weeks later and courtship takes place. Males swing their heads up and down and call to encourage the females to become receptive to mating (5). Eventually, two eggs are laid at the end of October, the second egg being the only one that is usually incubated (5). Royal penguins are monogamous and often form large colonies of up to 500,000 birds (5), together with the closely related rockhopper penguins. The nests are usually placed a few hundred metres from the sea and the birds make access routes through the tussock grass (4). Incubation lasts from 30-40 days (5), after which the male guards the chick for up to three weeks while the female provides food (4) (5). After this period, the demands of the chick make it necessary for both parents to collect food, and the chicks usually gather together in small crèches (4). Royal penguins feed largely on krill, small shrimp-like crustaceans, the rest of their diet comprising fish and squid. The parent birds regurgitate partially-digested food from their stomachs to feed their growing youngster (2). When it reaches some 70 days old, the chick will have fledged and can begin to fend for itself. It becomes sexually mature at one year (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

Royal penguins differ from the other crested penguins by having white or pale grey faces and chins (3). They have black crowns, backs and flippers flecked with white; short, stubby orange bills and sulphur-yellow crests above the eyes that join at the top of the head (4). Female birds are slightly smaller than the males, but otherwise, the sexes are similar (5). Royal penguins are sometimes confused with the Macaroni penguin (black chin and face), and some authorities consider the Royal a subspecies of the Macaroni (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This speciesis confined to Macquarie Island and nearby Bishop and Clerk Islands, Australia. However, small numbers of similar-looking birds appear at other sub-Antarctic islands (such as Kerguelen Island [Duriez and Delord 2012]), indicating that it may breed elsewhere. It was heavily exploited in the 19th century, but has recovered and, in 1984-1985, an estimated 850,000 pairs were breeding on Macquarie, with an earlier count of over 1,000 pairs on Bishop and Clerk. The population is believed to be stable.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Royal Penguins are a migratory species. All Eudyptes schlegeli make residence on Macquarie Island during the breeding season. The island is located off the South of Australia in the Pacific. It is uncertain where they go during the non-breeding season. Sightings have ranged from Tasmania all the way to the Antarctic sector of the Southern Ocean (Kerry and Clippindale 1997).

Biogeographic Regions: australian (Native ); pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Macquarie I. and adjacent islets.
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Royal penguins are migratory birds and outside of the breeding season are believed to spend their time in the southern seas between Australia and Antarctica. Their main breeding site is on Macquarie Island, situated roughly half-way between Tasmania and Antarctica, and managed by the Australian state of Tasmania (6). However, they were also recorded in the past as breeding in smaller numbers on New Zealand's South Island and Campbell Island (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Royal Penguins are often confused with Macaroni Penguins (Eudyptes chrysolophus) (Barham & Barham date unknown). In fact, both of these species were at one time considered to be the same species (Kerry and Clippindale 1997). They are the largest of the crested penguins standing about 70 cm in height. Females are usually slightly smaller than males. Both have yellow/orange and black crests that run from their sides all the way to the tops of their heads. The one distinguishing difference between Royal Penguins and Macaroni Penguins is that Royals have white chins and the Macaroni Penguins have black chins (Kerry and Clippindale 1997).

Range mass: 4000 to 5000 g.

Average length: 70 cm.

Other Physical Features: endothermic ; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It nests in huge colonies on bare, level, pebbly, rocky or sandy ground. When breeding, it feeds on euphausiids, fish and squid. Its ecology and movements during the winter when away from the island are unknown (Christidis and Boles 1994).


Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 212 specimens in 1 taxon.
Water temperature and chemistry ranges based on 212 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 5.950 - 5.950
  Nitrate (umol/L): 19.829 - 19.829
  Salinity (PPS): 34.005 - 34.005
  Oxygen (ml/l): 6.975 - 6.975
  Phosphate (umol/l): 1.408 - 1.408
  Silicate (umol/l): 6.646 - 6.646
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The only certain habitat of Eudyptes schlegeli is on Macquarie Island. The surface of the island is covered with rock and small shrubs.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 212 specimens in 1 taxon.
Water temperature and chemistry ranges based on 212 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 5.950 - 5.950
  Nitrate (umol/L): 19.829 - 19.829
  Salinity (PPS): 34.005 - 34.005
  Oxygen (ml/l): 6.975 - 6.975
  Phosphate (umol/l): 1.408 - 1.408
  Silicate (umol/l): 6.646 - 6.646
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The most important land habitat for the Royal penguin is Macquarie Island, which is dotted with rocks, tussock grass and small shrubs. The birds spend about seven months of the year in the coastal waters around this island (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

The diet of Eudyptes schlegeli consists primarily of euphausiid (26%) and myctophid (52%). Other forms of nourishment come from small fish, squid, and various crustaceans. One interesting observation is that different colonies of the penguins on Macquarie Island (notably the east and west coasts) show significant variations in diet (Kerry 1997).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Royal Penguins are monogamous (Waas et al. 2000). Reproduction only occurs on Macquarie Island from September to March. The season is marked when males arrive and begin building nests made out of grass and lined with small stones. The nests are easily distinguished from other crested penguin nests (Royal 1998). Females arrive in early October and lay eggs near the end of the month. Eudyptes schlegeli are known to breed in both large and small colonies. The largest colony is estimated to have around 500,000 pairs, while smaller colonies can contain a mere 70 to 200 pairs.

Two eggs are laid in the nest but only the second egg is incubated (Waas et al. 2000). Incubation takes approximately 30 to 40 days. When the chick hatches the male protects and raises it for 10 to 20 days. During this time the female penguin gathers and brings food to the nest daily. At an age of about 70 days, the chick is capable of leaving the nest and subsisting on its own. Royal Penguins reach sexual maturity in approximately one year (Royal 1998).

Key Reproductive Features: iteroparous ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Eudyptes schlegeli

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACCTTCATTAACCGATGACTATTCTCCACCAACCACAAAGATATCGGCACCCTCTACCTAATCTTCGGTGCATGAGCAGGCATAGCCGGAACTGCCCTTAGCCTACTCATCCGTGCAGAGCTCGGCCAACCTGGAACTCTCCTAGGAGACGACCAAATCTACAACGTAATCGTCACCGCCCATGCTTTCGTAATAATCTTCTTCATAGTAATACCCATTATGATCGGAGGATTCGGAAACTGACTAGTCCCCCTTATAATTGGCGCCCCCGACATAGCATTCCCCCGCATGAATAACATAAGCTTCTGACTACTCCCCCCTTCCTTCCTACTCCTACTAGCCTCCTCCACAGTAGAGGCAGGAGCTGGCACAGGATGAACTGTATACCCACCACTAGCGGGCAACCTAGCCCATGCCGGGGCATCTGTAGACTTAGCCATTTTCTCACTCCACCTAGCAGGAGTCTCCTCCATTCTTGGAGCAATTAACTTCATCACCACCGCCATCAACATAAAACCCCCAGCCCTCTCACAGTACCAAACCCCTCTATTCGTATGGTCCGTTCTTATCACAGCCGTCCTCCTACTACTCTCACTCCCCGTACTCGCTGCAGGCATCACCATGCTACTAACAGACCGAAACTTAAACACCACCTTCTTTGACCCTGCCGGAGGAGGTGACCCAATCCTATACCAGCACCTCTTTTGATTCTTCGGCCACCCAGAAGTCTATATCCTAATTCTACCAGGCTTCGGAATCATCTCTCATGTAGTAACATATTACGCAGGCAAAAAGGAACCCTTCGGCTACATAGGAATAGTATGAGCCATATTATCCATCGGATTCCTCGGCTTCATCGTATGAGCCCATCACATATTCACAGTCGGAATAGACGTAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Eudyptes schlegeli

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2015

Assessor/s
BirdLife International

Reviewer/s
Symes, A.

Contributor/s
Copson, G., Gales, R., Garnett, S. & Garca Borboroglu, P.

Justification
This species has a large population which is currently thought to be stable, it is confined to just three islands all in close proximity and as such it is susceptible to the effects of human activities or stochastic events. However there are currently no obvious threats that could result in the species qualifying for Critically Endangered in a short time period. The species is therefore classified as Near Threatened asit almost meets the requirements for listing as threatened under criterion D2.


History
  • 2012
    Vulnerable (VU)
  • Vulnerable (VU)
  • Vulnerable (VU)
  • Vulnerable (VU)
  • Vulnerable (VU)
  • Vulnerable (VU)
  • Vulnerable (VU)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)