Articles on this page are available in 1 other language: Spanish (7) (learn more)

Overview

Brief Summary

Sternula antillarum

A small (9 inches) tern, the Least Tern in summer is most easily identified by its black cap and white forehead, deeply-forked tail, black-tipped yellow bill, and dark wing tips. In winter, this species becomes duller on the head and face, becoming dark-billed and pale headed while retaining black eye-patches connected to a dull black hood. This species’ small size and yellow bill help distinguish it from other tern species occurring in its range. Male and female Least Terns are similar to one another in all seasons. The Least Tern breeds along coasts and large rivers across the United States. In winter, birds breeding in the U.S. spend the winter from Mexico south to southern South America. Other populations breed in Mexico, Central America, and parts of the Caribbean, many of which are non-migratory. Least Terns primarily breed sandy beaches, islands, and mud flats. In winter, this species may be found along beaches or in near-shore waters. Least Terns mainly eat small fish, but may eat small invertebrates, primarily crustaceans, as they become available. Least Terns may be most easily seen standing or walking along the shore or on the beach, where their dark wing tips and (in summer) yellow bill may be most apparent. With the aid of binoculars, it may also be possible to observe this species feeding by diving headfirst into the water. Least Terns are most active during the day.

Threat Status: Least Concern

  • Least Tern (Sterna antillarum). The Internet Bird Collection. Lynx Edicions, n.d. Web. 20 July 2012. .
  • Peterson, Roger Tory. Birds of Eastern and Central North America. Boston: Houghton Mifflin, 1980. Print.
  • Sterna antillarum. Xeno-canto. Xeno-canto Foundation, n.d. Web. 20 July 2012. .
  • Thompson, Bruce C., Jerome A. Jackson, Joannna Burger, Laura A. Hill, Eileen M. Kirsch and Jonathan L. Atwood. 1997. Least Tern (Sternula antillarum), The Birds of North America Online (A. Poole, Ed.). Ithaca: Cornell Lab of Ornithology; Retrieved from the Birds of North America Online: http://bna.birds.cornell.edu/bna/species/290
  • eBird Range Map - Least Tern. eBird. Cornell Lab of Ornithology, N.d. Web. 20 July 2012. .
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Institution

Supplier: DC Birds

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

The Least Tern breeds along almost the entire coast of North America, excluding Alaska and Canada, on the northern coast of Central America and locally on the northern coast of South America. It also breeds inland along rivers in central North America. It is migratory, wintering on the southern coast of Central America, and the northern and Atlantic coast of South America as far south as central Brazil (del Hoyo et al. 1996).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) BREEDING: Pacific coast, central California to southern Baja California and Chiapas (Garcia and Ceballos 1995); since 1970, most nesting has occurred from Santa Barbara to San Diego County, California. Interior U.S.: locally along the Colorado, Red, Arkansas, Missouri, Ohio, and Mississippi river systems; formerly more widespread and common; has been eliminated from much of former habitat; now breeds locally in this region, north to Montana and North Dakota, east to southwestern Indiana, central Kentucky, and western Tennessee, west to eastern Colorado. Atlantic-Gulf coast: Maine south to Florida and west to Tamaulipas, coast of Yucatan Peninsula, and in West Indies (Bahamas [Sprunt 1984], Greater and Lesser Antilles [van Halewyn and Norton 1984]); islands off coast of Belize, Honduras, and Venezuela; and Bermuda (Thompson 1995, AOU 1998). About 2/3 of world population breeds in the southeastern U.S.; largest colony is at Gulfport, Mississippi (Clapp and Buckley 1984). NON-BREEDING: regularly along Pacific coast from southern Mexico to Peru and eastern coasts of Mexico, Central America, and South America to Brazil and northern Argentina (Thompson et al. 1997, AOU 1998). May remain in wintering areas during first year (Thompson et al. 1995). Casual in Hawaii (Whitman 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Atlantic, Pacific, and Gulf coasts of North America, into interior along major river systems.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Length: 23 cm

Weight: 43 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Length: 22.5 cm, Wingspan: 50 cm
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Differs from other sympatric terns in being much smaller (averages 23 cm long vs. 37 cm in common tern [STERNA HIRUNDO]). No other sympatric tern has, in breeding plumage, a combination of a white forehead, yellowish legs, and pale gray mantle. In winter plumage, differs from winter Forster's tern (STERNA FORSTERI) in being much smaller, differs from winter black tern (CHLIDONIAS NIGER) in having yellowish feet and legs (dark in the black tern).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species can be found on lakes, rivers and estuaries, strictly on the coast in some regions (e.g. California) but inland in others (e.g. Florida). It feeds on small fish fry, shrimps, marine worms and occasionally flying ants and other insects. Prey are usually caught by plunge-diving up to 10 m, preceded by prolonged hovering, and it also occasionally performs surface-dipping and aerial hawking. The breeding season begins between April and mid-June depending on locality, and it breeds in a large variety of habitats, from barren sandy beaches to parking lots and roof tops. Individuals form colonies usually between 5 and 200 pairs strong. It is a highly migratory species, though some populations in the north of South America, and on the Pacific coast of Mexico may be year-round residents (del Hoyo et al. 1996).


Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 65 specimens in 1 taxon.
Water temperature and chemistry ranges based on 25 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 24.203 - 27.711
  Nitrate (umol/L): 0.253 - 1.328
  Salinity (PPS): 33.535 - 35.931
  Oxygen (ml/l): 4.463 - 4.982
  Phosphate (umol/l): 0.056 - 0.385
  Silicate (umol/l): 0.936 - 3.015

Graphical representation

Temperature range (°C): 24.203 - 27.711

Nitrate (umol/L): 0.253 - 1.328

Salinity (PPS): 33.535 - 35.931

Oxygen (ml/l): 4.463 - 4.982

Phosphate (umol/l): 0.056 - 0.385

Silicate (umol/l): 0.936 - 3.015
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: BREEDING: Seacoasts, beaches, bays, estuaries, lagoons, lakes, and rivers (AOU 1983). Rests and loafs on sandy beaches, mudflats, and salt-pond dikes (Stiles and Skutch 1989). In California, may roost at night on sandy beaches away from nesting areas for several weeks before nesting. Nests usually in shallow depression on level ground on sandy or gravelly beaches and banks of rivers or lakes, typically in areas with sparse or no vegetation (usually less than 20% vegetation cover, often 10% or less; Bent 1921, Craig 1971, Jernigan et al. 1978, Thompson and Slack 1982, Faanes 1983, Gochfeld 1983, USFWS 1990); also on dredge spoils; on mainland or on barrier island beaches; and on flat gravel-covered rooftops of buildings (especially in the southeastern U.S.) or other similarly barren artificial sites (AOU 1983). Good nesting areas tend to be well beyond the high tide mark, have shell particles/stones/debris for egg camouflage (Burger and Gochfeld 1990), be out of the way of off-road vehicles and public recreation areas, not subject to unusual predation pressure, and adjacent to plentiful sources of small fishes. Colonies on small islands usually experience less mammalian predation (Burger 1984). Good roof-top sites provide some shade for chicks.

Adults do not require cover during the breeding season, but chicks may use sparse vegetation and debris for shade and protection (Hardy 1957, Blodgett 1978). Parents may lead chicks toward the periphery of the colony into more heavily vegetated areas (Akers 1975), where the young utilize debris and vegetation for cover (Hardy 1957). In coastal areas, beach grass (AMMOPHILA BREVILIGULATA) is the commonly associated vegetation. Along river systems, willow (SALIX spp.) is the common vegetation adjacent to sites (Sidle, pers. comm.). On Oklahoma salt flats, almost 60% of the nests were within 5 cm of debris (Grover and Knopf 1982).

Interior populations nest mainly on riverine sandbars or salt flats that become exposed during periods of low water (Hardy 1957). As a result of vegetational succession and/or erosion, preferred nesting habitat typically is ephemeral. Hardy (1957) implied that breeding in riverine situations depends on the presence of sandbars, favorable water levels during nesting season, and sufficient food. Nests are usually located at higher elevations and away from the water. Water levels determine the size of sand bars and the extent of nesting areas (USFWS 1990). Dams above colonies generally lower habitat quality by eliminating the spring floods that are necessary for alluvium deposition and the scouring of vegetation. Ducey (1982) reported successful breeding at two privately-owned sand and gravel companies along the Platte River in Nebraska. As old breeding sites became unsuitable due to vegetation encroachment, the terns simply moved to more recently created sand deposits. See also Ziewitz et al. (1992) for information on nesting habitat in the Platte River in Nebraska. Populations in Kansas have nested on oil well sites (Schulenberg and Ptacek 1984).

Since least terns always nest near water, they are vulnerable to flood inundation and seem to seek high ground. In coastal Texas, Thompson and Slack (1982) documented that the densest nesting area in 67% of the colonies was above the midpoint of available elevations. Gochfeld (1983) found that terns on Long Island avoid beaches that have less than 32.8 feet (10 m) of width beyond the hightide mark. Interior least tern nests on salt plains in Oklahoma were located an average of 110.5 m away from the nearest water (Grover and Knopf 1982). However, nests on the Platte River in Nebraska, were located at an average of 18.9 m away from the nearest river channel on sand bars that averaged 58.9 m wide (Faanes 1983).

NON-BREEDING: flocks have been found at sea, often far from land, in southeastern Caribbean and adjacent Atlantic off Guianas (van Halewyn and Norton 1984).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 65 specimens in 1 taxon.
Water temperature and chemistry ranges based on 25 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 24.203 - 27.711
  Nitrate (umol/L): 0.253 - 1.328
  Salinity (PPS): 33.535 - 35.931
  Oxygen (ml/l): 4.463 - 4.982
  Phosphate (umol/l): 0.056 - 0.385
  Silicate (umol/l): 0.936 - 3.015

Graphical representation

Temperature range (°C): 24.203 - 27.711

Nitrate (umol/L): 0.253 - 1.328

Salinity (PPS): 33.535 - 35.931

Oxygen (ml/l): 4.463 - 4.982

Phosphate (umol/l): 0.056 - 0.385

Silicate (umol/l): 0.936 - 3.015
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Saltwater beaches, bays, and salt flats, also along large rivers.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Breeders from the U.S. Atlantic coast migrate through the Caribbean region (van Halewyn and Norton 1984). Arrives in northeastern U.S. mainly in May; departs in August or generally not later than mid-September (Bull 1974, Dorr 1976).

Arrives in northern breeding areas on west coast mostly in April; most have departed for south by November (or as early as August); wintering area is unknown but probably is in western Mexico.

Wintering area for the breeding population in the interior U.S. is unknown (perhaps coastal Central America/northern South America?) (Matthews and Moseley 1990). Most arrive in Iowa/Nebraska in May.

Migrates in Costa Rica late-August to late October, and April (Stiles and Skutch 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Moves south to tropical waters in winter.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Eats mainly small fishes (generally less than 9 cm long), sometimes crustaceans or insects, obtained by diving from air into shallow water usually less than 4 m deep (Moseley 1976). Interior populations depend almost entirely on cyprinids. Feeding in newly plowed fields has been observed in Texas; apparently beetle larvae were being captured (McDaniel and McDaniel, 1963, Auk 80:544).

When breeding, usually forages within a few hundred meters of colony, but occoasionally up to 3-12 kilometers away (summarized by Thompson et al. 1997). Coastal breeding populations may forage in marine, estuarine, or nearby freshwater habitats.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Mainly feeds on fish, crustaceans and insects, including some mollusks and marine worms when necessary.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Comments: Widely distributed, but difficult to estimate because nesting habitat is ephemeral and nesting sites may change location from year to year.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

10,000 - 100,000 individuals

Comments: Gulf and Atlantic coast populations included about 43,000 breeding birds in the mid-1980s (USFWS 1987). Atlantic coast population from Maine to Virginia was 9341 breeding pairs in 1986 (Engstrom et al. 1990). Long Island (New York) population was about 2500-3600 pairs in 47-59 colonies in the mid-1980s (MacLean et al. 1991). In the Florida Keys in the late 1980s, there were 37 colonies on 16 keys. Interior population was about 5000 pairs in 1990 (USFWS), estimated at 6,833 birds [pairs?] in 1991 (Kirsch and Sidle 1994). California population was about 1700 pairs in 1992 (Massey, pers. comm. 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

In California, usually nests in same area in successive years; tends to return to natal site to nest (Atwood and Massey 1988). On Long Island, New York, tends to nest in same area in successive years if physical conditions are conducive to nesting (MacLean et al. 1991).

NON-BREEDING: usually singly or in small loose groups; in larger flocks when migrating. Foraging may occur singly, in pairs, or in small flocks (Erwin 1978).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 24.1 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Courtship behavior includes chases, vocalizations, and sometimes presentation of a fish to the female by the male. Lays eggs mostly in May-June (July-August nests probably are renests). Renesting may occur after egg loss associated with heavy rains and/or flooding (Jernigan et al. 1978, Blus and Prouty 1979). Clutch size usually is 2-3 (most often 2 in California, New York, and Mississippi), rarely up to 4-5 (Hardy 1957, Swickard 1974, Houde 1977, Hays 1980, Faanes 1983). Incubation usually lasts 20-25 days (also reported as 21-22 days), by both sexes but mostly by female. Hatching success varies greatly and is affected by factors such as weather, tides, predation, and human disturbance; may be high under optimal conditions. Young are tended by both parents, leave nest after a few days, brooded for several days, fly at about 3-4 weeks, dependent for a few weeks more. Reproductive success rarely exceeds one chick per pair (Kress et al. 1983). First breeds generally when about one year old, sometimes not until two years old (Massey and Atwood 1981). Maximum known natural longevity 21 years (Massey and Atwood 1978, Clapp et al. 1982). In recent years, colonies generally have included not more than 20 pairs, sometimes up to about 75 pairs (Ehrlich et al. 1992), rarely up to several hundred pairs. Colony may be divided into subcolonies (Massey 1974).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Nest is built on open ground among colony usually. 1-3 eggs, incubated by both partners for 20-25 days. Young are fed by both parents. Capable of flight around 19-20 days old.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Sternula antillarum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACATTCATCAACCGATGACTATTTTCAACAAACCACAAAGATATCGGCACTCTATACTTAATTTTCGGCGCATGAGCTGGTATAGTAGGTACTGCTCTTAGCTTACTTATTCGTGCAGAACTGGGTCAACCAGGAACTCTCCTAGGAGATGACCAAATCTACAACGTAATCGTCACCGCCCACGCCTTTGTAATAATTTTCTTTATAGTAATGCCCATCATAATTGGTGGCTTCGGAAACTGACTAGTACCTCTCATAATTGGTGCCCCCGACATAGCATTTCCACGCATAAACAACATAAGCTTCTGACTGCTGCCCCCATCATTCTTACTCCTCCTAGCCTCTTCCACCGTAGAAGCTGGAGTAGGTACAGGATGAACCGTATATCCTCCCCTAGCTGGCAATCTAGCCCATGCTGGAGCTTCAGTAGACTTAGCAATCTTCTCCCTTCATCTAGCAGGTGTATCTTCCATCCTAGGTGCTATTAATTTCATCACCACAGCCATCAACATAAAACCCCCTGCCCTTTCACAATACCAAACCCCTCTGTTCGTATGATCTGTACTCATCACTGCTGTCCTACTACTACTCTCACTCCCAGTGCTCGCCGCTGGCATTACCATGTTATTAACAGACCGAAACCTAAACACAACATTCTTCGACCCTGCTGGAGGTGGTGACCCTGTGTTATACCAACATCTTTTCTGATTCTTCGGCCACCCAGAAGTATATATTTTAATCCTACCAGGCTTTGGCATCATCTCCCACGTCGTAACATACTATGCAGGTAAGAAAGAACCATTTGGCTACATAGGAATAGTATGAGCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Sternula antillarum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5