Overview

Distribution

Range Description

The Black Guillemot can be found throughout Arctic waters on the northern coasts of Russia, Alaska (USA), Canada and Norway, in the Atlantic Ocean off Greenland (to Denmark), eastern Canada as far south as the United Kingdom including the North and Baltic Sea (del Hoyo et al. 1996).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North America; range extends throughout the Canadian Atlantic
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

circum-arctic
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The Black guillemot is a circumpolar species distributed in boreal, low arctic and high arctic regions of the North Atlantic and Arctic oceans. Black guillemots can be found in coastal areas from the Gulf of Maine, New England across parts of the northern coast of North America, as far as Alaska. In Europe and Asia they are found from the British Isles and northward across the northern coast of Asia. The largest concentrations can be found among islands of the high and low arctic. Wintering populations disperse as far south as Rhode Island in North America and France in the eastern Atlantic (Johnsgard 1987; Nettleship and Evans 1985; Nettleship 1996).

Biogeographic Regions: arctic ocean (Native ); atlantic ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Breeding range extends from the eastern Canadian Arctic and western Greenland south to the Gulf of Maine, east to the northern British Isles, Scandanavia, and Baltic Sea, and east along northern Russia to the Chukchi and Beaufort seas, including Alaska (Butler and Buckley 2002). In winter, most tend to stay near breeding areas (if open water is available).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Circumpolar. South to New Jersey and to northern France.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

A relatively small seabird, Black guillemots are approximately 32cm in length. In breeding plumage, as their name implies, Black guillemots are black from bill to tail. They also have large white wing patches, and bright red feet, legs and inside the mouth. As many as seven sub-species have been described based on variations in size, bill and wing length, and plumage. After an early fall moult adults take on a patchy black and white plumage that has been described as "salt and pepper" and legs become a paler red. This winter plumage retains the white wing patch on the black wing, however the body plumage becomes white below and barred black and white above with a black bill and mostly white head. Newly fledged birds are similar to wintering adults and yearlings have an adult-like plumage with brownish spots in the white wing patch (Bedard 1985; Gaston 1985; Johnsgard 1987; Nettleship 1996; Stokes and Stokes 1996).

Range mass: 325 to 550 g.

Other Physical Features: endothermic ; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 33 cm

Weight: 428 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Length: 30-36 cm, Wingspan: 58 cm
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Behaviour Black Guillemots are pursuit divers that propel themselves through the water using their wings. Diet The species is probably primarily a benthic forager, since much of the prey consists of benthic fish and invertebrates, including crustaceans (Bradstreet and Brown 1985, Cairns 1987a, BirdLife International 2000). Various studies find sandeels (Ammodytes spp.) (Harris and Riddiford 1989, Ewins 1990) and blennies (particularly butterfish Pholis gunnellus) (Harris and Riddiford 1989, Ewins 1990, BirdLife International 2000) to be the most important prey species of fish, although the relative contributions of each of these to the overall diet differs. Flatfish (Harris and Riddiford 1989) and gadoids (Ewins 1990) are also sometimes important. Amongst invertebrates, sea-scorpions are noted as an important prey item (Harris and Riddiford 1989). Adults tend to consume a higher proportion of invertebrates than chicks (Ewins 1990). The general trend is for increasing importance of invertebrates with latitude (presumably reflecting overall availability) in the summer diet of both adults and chicks. The few data on winter food suggest that invertebrates are of greater importance during the winter than during the summer (Ewins 1990). Breeding site Both early spring and breeding distributions appear to be influenced by the Hell Gate and Cardigan Strait polynya located in western Jones Sound, Canada, between Ellesmere and Devon islands. The evidence presented suggests that annual variation in the distribution of ice edges in Jones Sound may influence the distribution of breeding birds among suitable breeding habitat. The observed distribution of Guillemots in March, April, and May is coincident with the location of open water and the associated ice edges. Thereafter, as the ice margin recedes and shoreleads open, the distribution of Guillemots tends to reflect the location of breeding colonies (Prach and Smith 1992). Foraging range Birds feeding in the eastern Canadian Arctic fed principally in waters 10-130 m deep (Cairns 1987a). Birds have been caught in nets up to 50 m deep, but have a theoretical maximum dive of 130 m. They have been observed actively feeding in water 35-45 m deep (Uspenski 1956). However, in Kattegatt, Denmark, approximately 80% of all Black Guillemots were recorded in water with depths of 10-30 m (Durinck et al. 1994). Black Guillemots were always recorded less than 5 km from the coast of Caithness, Scotland during May-July (BirdLife International 2000). At the Bay of Fundy, Canada, almost all birds remained within 300 m of the shore (Ronconi and St. Clair 2002). At Papa Westray, Scotland, the mean foraging distance was 2.4 km away from the colony, and birds were recorded foraging in areas up to 3.9 km away from the colony, but despite this large variation in foraging range, feeding sites were never located further than 1.5 km from the shore (BirdLife International 2000). At Rockabill, Ireland, birds forage within 1 km of the colony or else fly 7km or more to reach the mainland coast (BirdLife International 2000). In the eastern Canadian Arctic, censuses indicated that most birds were feeding within 13 km of breeding colonies, with a few found as far as 15 km (BirdLife International 2000). Sightings were frequently highest within 5 km of the colony (BirdLife International 2000). Several studies (at the Bay of Fundy, Finland, Denmark and Iceland) found that Black Guillemots foraged between 0.5 and 4 km from nest sites, and occasionally beyond 7 km away (BirdLife International 2000). By contrast, in the NW Territories, Canada, breeding adults rarely foraged close to the colony, and some birds may have been travelling as far as 55 km (BirdLife International 2000). Birds probably capture some prey in the water column, but forage principally on benthic prey (Cairns 1987a). In Shetland, birds tend to forage where the sea bed is rocky and vegetated with dense stands of kelp (Laminaria spp.) (Ewins 1990) which reflects the habitat preferences of their main prey (BirdLife International 2000).

Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 3171 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1174 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): -1.109 - 12.348
  Nitrate (umol/L): 0.703 - 10.275
  Salinity (PPS): 6.218 - 35.391
  Oxygen (ml/l): 6.076 - 9.084
  Phosphate (umol/l): 0.231 - 1.130
  Silicate (umol/l): 0.565 - 12.889

Graphical representation

Temperature range (°C): -1.109 - 12.348

Nitrate (umol/L): 0.703 - 10.275

Salinity (PPS): 6.218 - 35.391

Oxygen (ml/l): 6.076 - 9.084

Phosphate (umol/l): 0.231 - 1.130

Silicate (umol/l): 0.565 - 12.889
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Generally Black guillemots are restricted to rocky shores due to their nesting requirements. They nest most often in crevices among stones and boulders at the base of cliffs or cracks in cliffs, and less often under rocks among vegetation and under driftwood. In the high arctic some cliff sites may be as high as 230m. Artificial cover (debris on shore, harbor walls, under buildings) has allowed guillemots to nest in areas where they may not have previously.

Foraging habitat varies dramatically with the seasons. During the breeding season birds forage in inshore waters generally less than 50m in depth. Although they remain fairly close to shore year round, in winter months black guillemots are more pelagic, frequently feeding along pack ice edges where pack ice occurs. Some overwinter in polynyas of the high north (Brown 1985; Cairns 1992; Harris and Birkhead 1985; Johnsgard 1987; Nettleship 1996; Winn 1950).

Aquatic Biomes: coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Black guillemots nest in holes under rocks (rarely in ground) on rocky islands, among boulders at base of coastal cliffs, in or under beach flotsam and other human debris (e.g., in northern Alaska), or in coastal cliff crevices. Females tend to nest in the same site in successive years. In winter, they inhabit rocky seacoasts, open sea, or margins of landfast ice, seldom far from shore.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 3171 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1174 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): -1.109 - 12.348
  Nitrate (umol/L): 0.703 - 10.275
  Salinity (PPS): 6.218 - 35.391
  Oxygen (ml/l): 6.076 - 9.084
  Phosphate (umol/l): 0.231 - 1.130
  Silicate (umol/l): 0.565 - 12.889

Graphical representation

Temperature range (°C): -1.109 - 12.348

Nitrate (umol/L): 0.703 - 10.275

Salinity (PPS): 6.218 - 35.391

Oxygen (ml/l): 6.076 - 9.084

Phosphate (umol/l): 0.231 - 1.130

Silicate (umol/l): 0.565 - 12.889
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Oceanic; usually inshore, but also offshore. Rocky coastlines.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Young move away from breeding site in direction of prevailing current; see Brown (1985) for details for western Atlantic and elsewhere.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Some move to southern part of range, but most remain north at edges of pack ice in open water.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Like other members of the Alcidae family, C. grylle are adapted to wing-propelled swimming allowing them to dive deeply where they feed mainly on fish on or near the seafloor. Prey items include sandlance (Ammodytidae), gunnels (Pholidae), sculpins (Cottidae), pricklebacks (Stichaeidae), Arctic cod (Boreogadus saida) and many other fish as well as many invertebrates: polychaetes, molluscs, jellyfish, crustaceans, sponges, crabs, and even barnacles. They are known to dive for nearly 2 minutes and up to estimated depths of 50m. Many patterns of foraging behavior have been found. There is typically a morning, and sometimes evening, peak in foraging activity, but in some areas feeding may be continuous throughout daylight hours. Foraging distribution has been shown to change with tidal cycles where birds prefer waters of moderate flow. Seasonal cycles also exist with guillemots feeding inshore during the breeding season and farther offshore or around pack ice edges during the winter (Bradstreet and Brown 1985; Cairns 1986; Cairns 1992; Johnsgard 1987; Nettleship 1996; Nol and Gaskin 1987; Winn 1950).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Eats small fishes and invertebrates found on or near bottom in shallow water or in deeper water near pack ice. Chicks are fed mainly fishes (and invertebrates in high arctic. Forages close to colony (usually 4 km or less).

Black guillemots feed by diving underwater in relatively shallow water (usually less than 50 meters deep). Dives last up to 2.5 minutes but usually are closer to 1 minute in duration, depending on water depth.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Fish and crustaceans mainly. Also mollusks, marine worms, some plant material.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: > 300

Comments: Many occurrences throughout northern waters, primarily in the eastern Arctic and north Atlantic.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

100,000 to >1,000,000 individuals

Comments: Global breeding population estimated to be 500,000 to 1,000,000 (Gaston and Jones 1998). Accurate census extremely difficult (Butler and Buckley 2002). Censuses in 1970s and early 1980s yielded estimate of about 5000 pairs in New England, about 70,000 in eastern Canada (Nettleship and Evans 1985). A few hundred in Alaska (Lensink 1984). See Evans (1984) for population data from Greenland.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Despite larger clutch size, breeding success (about 0.6-0.8 young fledged per pair) is similar to that one other alcids that lay only 1 egg (Harris and Birkhead 1985).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Average lifespan

Status: wild:
157 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 25.9 years (wild) Observations: Maximum longevity from banding studies is 25.9 years (http://www.euring.org/data_and_codes/longevity.htm).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Black guillemots breed in relatively small scattered colonies and lay 2 eggs. The typical reproductive cycle is as follows. Some adults over-winter near breeding colonies while the others return between late February and early May. Birds have been seen searching for suitable nest sites (see habitat section for nesting requirements) immediately after copulation and eggs are usually laid between late May and mid June. Guillemots have a double brood patch; two eggs are the standard clutch size but sometimes one and more rarely three are laid. More experienced parents often lay slightly earlier and have a larger mean clutch size. Once the last egg is laid incubation is continuous with both parents sharing shifts for 28 to 32 days. Colony attendance is highest in the early morning. Down-covered semi-precocial chicks take 3 to 4 days to fully hatch then are left unattended in the nest. As the chicks get older they wander inside the nest crevice. Both sexes feed the demanding chicks up to 20 fish a day until they fledge at age 30 to 40 days. Sometimes parents must entice young from the nest with fish, but once fledged, chicks are on their own. The average breeding success ranges from 0.48 to 1.6 young per pair with losses due to predation, bad weather, and flooding from high tides. By age three or four, young birds start to breed and join this cycle (Harris and Birkhead 1985; Hilden 1994; Johnsgard 1987; Nettleship 1996; Winn 1950).

Key Reproductive Features: iteroparous ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Average time to hatching: 25 days.

Average eggs per season: 2.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eggs are laid mainly in May-June in southeastern Canada, late June-early July in Beaufort Sea area (Johnson and Herter 1989). Clutch size is 1-2. Incubation, by both sexes, lasts 23-39 days (average 4-4.5 weeks). Young are tended by both parents; most leave the nest area and are independent by 31-51 days. Individuals first breed at an age of 2+ years. Nesting usually occurs in small groups or as single pairs.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

First breeds at 4 years old. May nest in colonies or as isolated pairs, with nest sheltered by large rocks or other debris. 1-2 eggs, incubated by both partners for 23-39 days. Young fed whole fish by both parents. Young leave nest independently but before capable of flight.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cepphus grylle

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 11 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTTTCTCCAACCCACAAAGACATTGGCACCCTATATTTAATCTTCGGTGCATGAGCCGGTATAGTCGGCACTGCCCTAAGCTTACTCATCCGTGCAGAACTAGGTCAACCAGGAACTCTTCTAGGAGACGACCAAATTTACAACGTAATTGTCACAGCCCACGCCTTCGTAATAATTTTCTTCATAGTAATGCCAATCATAATTGGAGGCTTCGGAAACTGATTAGTCCCACTTATAATCGGTGCCCCCGATATAGCATTCCCTCGCATGAACAACATAAGCTTCTGACTACTCCCCCCATCATTCCTACTCCTCCTAGCTTCTTCTACAGTAGAAGCTGGAGCTGGTACAGGATGAACTGTATACCCTCCCCTAGCCGGTAACCTAGCACACGCCGGAGCTTCAGTAGATCTTGCAATCTTCTCCCTCCACTTAGCAGGTGTATCTTCCATTCTGGGTGCTATCAACTTTATCACAACAGCCATCAACATAAAACCTCCAGCCCTCTCACAATACCAAACCCCACTATTTGTATGATCAGTACTTATTACCGCTGTCTTATTATTACTCTCCCTCCCAGTACTCGCTGCTGGTATTACTATACTACTAACAGACCGAAACCTAAATACAACATTCTTTGACCCAGCCGGAGGTGGTGATCCAGTACTATATCAACACCTCTTCTGATTCTTTGGACATCCAGAAGTATACATCCTAATTCTACCAGGATTTGGAATTATCTCCCACGTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cepphus grylle

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 11
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5