Articles on this page are available in 1 other language: Chinese (Simplified) (11) (learn more)

Overview

Comprehensive Description

Miscellaneous Details

"They make engaging pets, becoming exceedingly tame and confiding, following their master about and flying long distances when called."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Summary

"A common bird of hill forests and urban gardens. Distinguished by a tall pointed black crest, red face patch and brownish upper parts."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Global Range: Native to south-central and southeastern Asia. Introduced and established in Hawaii (well established in Honolulu, Oahu; expanding throughout island), southern Florida, Australia, and Nicobar Islands.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

"Distinguishable at a glance from the foregoing by the presence of an upstanding, pointed black crest which sometimes curves forward almost over the beak. The crimson ' whiskers ' and undertail patch, and white underparts are other diagnostic features. Sexes alike."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 18 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

"Somewhat smaller and slimmer than the Myna. (8"""")."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

SubSpecies Varieties Races

P. j. jocosus P. j. fuscicaudatus P. j. abuensis P. j. pyrrhotis P. j. emeria P. j. whistleri P. j. monticola P. j. pattani P. j. peguensis
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Forest edge and clearings, second-growth woodland, brushy areas, cultivated lands, villages, suburban residential areas (AOU 1983). Suburbs and parklands of Miami area in Florida. Nests in shrub, small tree, or vine, usually in twig fork, 0.5-2.5 m above ground (Harrison 1978).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Habitat

In gardens and open scrub country.
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Eats mainly fruits, also flowers, buds, nectar, seeds, and some insects. Fruits of "Brazilian pepper tree" important in Florida. (Terres 1980). Nestlings initially fed soft-bodied insects and caterpillars, later berries and fruits.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Behaviour

"The Red-whiskered Bulbul is another of the more familiar birds of our gardens and countryside, being found wherever trees afford the prospect of food and shelter, not uncommonly in the heart of noisy cities. Its joyous, querulous notes may be heard at all hours of the day. The birds go about in pairs, """"but numbers will collect at some tree or shrub in fruit. Their diet consists principally of berries— those of the Lantana being a favourite— but they also devour a considerable number of spiders, insects and caterpillars."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 11.1 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Eggs have been recorded in March in Florida; nests January-August in Hawaii. Clutch size is 2-4 (usually 3); 2-3 broods per year in India. Incubation, by both sexes, lasts 12-14 days. Young are tended by both parents, leave nest at about 13 days, independent at 3 weeks.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

"Nests may be found at all seasons of the year, but chiefly from February to August. The nest, like that of the Red-vented Bulbul, is a compact cup made of rootlets, fine twigs and grass. Casuarina needles are utilised where available. The site selected is usually some low tree, shrub or hedge in a garden or in scrub country, there being little effort at concealment. Occasionally it is placed in the thatch or palm-leaf walls and roofs of huts, the birds sitting complacently on the eggs or feeding the young within a few inches of the inmates. The eggs—two to four in number—are very similar to those of the last species. Both sexes share in next building, incubation and care of the young. The incubation period is 15-16 days. Two, or even three, broods are frequently raised or attempted in succession, the casualty among the eggs and young being amazingly heavy."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pycnonotus jocosus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATACCTAATTTTCGGCGCATGAGCCGGGATAGTAGGTACCGCCCTAAGCCTCCTCATTCGAGCAGAACTAGGCCAACCTGGCGCTCTTCTAGGAGATGATCAAATCTACAATGTAGTAGTCACAGCCCATGCTTTCGTAATAATTTTCTTTATAGTCATACCAATCATAATTGGCGGATTTGGAAACTGACTAGTACCCCTAATAATTGGAGCCCCAGATATAGCTTTCCCTCGAATAAACAACATAAGCTTCTGGCTACTTCCCCCATCTTTCCTCCTACTACTAGCCTCATCCACAGTGGAAGCAGGAGCTGGAACAGGTTGAACCGTGTACCCACCACTGGCTGGCAACCTAGCCCACGCTGGAGCCTCAGTCGACCTAGCCATCTTCTCCCTCCACTTAGCAGGTATCTCCTCAATCTTAGGAGCAATTAACTTTATCACAACAGCAATCAACATAAAACCCCCAGCCCTATCACAATACCAAACCCCCCTATTTGTATGATCCGTCTTAATCACTGCAGTCCTACTTCTCCTGTCCCTTCCAGTTCTTGCAGCTGGTATTACCATGCTACTCACCGACCGTAACCTTAACACCACCTTCTTTGACCCCGCAGGAGGAGGAGACCCAGTACTATACCAACACCTTTTCTGATTTTTCGGTCATCCAGAAGTCTATATCCTAATCCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Pycnonotus jocosus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5