Articles on this page are available in 1 other language: Chinese (Simplified) (11) (learn more)

Overview

Brief Summary

Lanius excubitor

A medium-sized (9-10 inches) shrike, the Northern Shrike is most easily identified by its gray body, dark wings, and large hooked bill. Other field marks include a black tail with white edges, a black eye-stripe, and white “wrists” visible on the underside of the wings. Male and female Northern Shrikes are similar to one another in all seasons. The Northern Shrike inhabits a large portion of the Northern Hemisphere. In North America, this species breeds across Alaska and north-central Canada. Typically, this species winters further south along the coast of Alaska, in southern Canada, and in the northern United States. However, depending on the severity of the winter, Northern Shrikes may winter as far north as the Arctic Circle or as far south as central New Mexico and the Mid-Atlantic region. In the Old World, this species breeds widely from the arctic south to sub-Saharan Africa and India, with northern populations migratory and southern populations permanent residents. Northern Shrikes breed in open northern forests near the edge of the tundra. During the winter, this species is found in a greater variety of open habitats, including grasslands, wetlands, deserts, and agricultural fields. Northern Shrikes eat a variety of small animals, including insects, small mammals, and birds. Due to the relative inaccessibility of this species’ breeding grounds, most North American birdwatchers only observe Northern Shrikes during the winter. At this time of year, Northern Shrikes are most easily observed perching in prominent areas, such as on bare branches, while watching for prey. This species impales its prey on thorns or barbed wire, and birdwatchers who stumble across one of these “larders” would likely find a Northern Shrike nearby. This species is primarily active during the day.

Threat Status: Least Concern

  • Cade, Tom J. and Eric C. Atkinson. 2002. Northern Shrike (Lanius excubitor), The Birds of North America Online (A. Poole, Ed.). Ithaca: Cornell Lab of Ornithology; Retrieved from the Birds of North America Online: http://bna.birds.cornell.edu/bna/species/671
  • Great Grey Shrike (Lanius excubitor). The Internet Bird Collection. Lynx Edicions, n.d. Web. 20 July 2012. .
  • Lanius excubitor. Xeno-canto. Xeno-canto Foundation, n.d. Web. 20 July 2012. .
  • Peterson, Roger Tory. Birds of Eastern and Central North America. Boston: Houghton Mifflin, 1980. Print.
  • eBird Range Map - Northern Shrike. eBird. Cornell Lab of Ornithology, N.d. Web. 20 July 2012. .
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Institution

Supplier: DC Birds

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: BREEDS: North America from Alaska across northern Canada to Labrador; also Old World. WINTERS: North America from central Alaska and southern portions of breeding range in Canada south to central California, northern Illinois, New Jersey. Southern range limit and numbers on winter range vary unpredictably.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Length: 25 cm

Weight: 66 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Open deciduous or coniferous woodland, taiga, thickets, bogs, scrub and, locally, semi-desert; in migration and winter also in open situations with scattered trees, savanna and cultivated lands (AOU 1983). In Idaho, riparian corridors (for night roosts) and rimrock outcroppings (for foraging) appeared to be important in winter; roosted in deciduous shrubs with many small stems (Atkinson 1993). Nests in trees or bushes, usually 1.5-6 m above ground (Terres 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Mostly a long-distance migrant; breeding and winter ranges overlap in southern Alaska and northwestern Canada.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Feeds on mice, voles, small birds, snakes, lizards, and frogs; also eats a wide variety of insects. In Idaho in winter, small mammals were the most important prey; also ate many arthropods and some birds (Atkinson and Cade 1993). Usually sits on an exposed perch and watches for prey.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Known prey organisms

Lanius excubitor preys on:
Pseudacris triseriata
Eumeces fasciatus
Junco hyemalis
Passer domesticus

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

On breeding grounds, foraging home range estimated to be 130 hectares (Cade 1967). In Idaho, winter territory size was 55-357 hectares (mean 216 hectares), with a main core area (over one-half of activity) averaging 50 hectares (Atkinson 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 12 years
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Breeding begins mid-late May (Harrison 1978). Clutch size is 2-9 (usually 4-6). Incubation is done mainly by female (Terres 1980). Young are tended by both adults, leave nest 20 days after hatching, independent in 10 more days. Single brooded (E. Atkinson, pers. comm.).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Lanius excubitor

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 12 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTTTTCTCCAACCCACAAAGACATTGGCACTCTGTACCTAATCTTCGGAGCATGAGCCGGAATGATTGGTACCGCCCTAAGCCTCCTCATTCGAGCAGAACTAGGACAACCCGGTGCTCTTCTAGGAGACGATCAAATTTACAATGTAATTGTTACAGCTCATGCTTTCGTAATAATTTTCTTCATAGTTATACCTATTATAATCGGAGGGTTTGGAAACTGATTAGTCCCACTAATAATCGGTGCCCCAGACATAGCATTCCCACGAATAAATAACATAAGTTTCTGACTTCTACCCCCATCATTTCTCCTCCTACTAGCCTCTTCAACAGTAGAAGCAGGAGCAGGAACAGGATGAACTGTATACCCACCATTAGCTGGCAACCTAGCCCATGCTGGAGCCTCAGTCGACTTAGCCATCTTTTCACTACACCTGGCAGGTATCTCATCAATCCTAGGAGCAATCAACTTTATCACAACAGCAATTAACATAAAACCTCCTGCCCTGTCACAATACCAAACCCCACTATTTGTATGATCAGTGCTAATCACTGCAGTGCTGCTACTTCTTTCCCTACCAGTACTTGCCGCCGGAATCACTATGCTTCTTACAGATCGTAACCTAAACACCACATTCTTTGACCCAGCAGGAGGAGGAGATCCAGTACTATACCAACACCTATTCTGATTCTTCGGCCACCCAGAAGTTTACATCCTAATTCTACCAGGATTTGGAATTATCTCCCACGTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Lanius excubitor

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 15
Specimens with Barcodes: 16
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Not Recognized (NR)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)