Articles on this page are available in 1 other language: Spanish (11) (learn more)

Overview

Brief Summary

Spinus tristis

A small (5 inches) finch, the male American Goldfinch in summer is most easily identified by its bright yellow body; black cap, wings, and tail; and conspicuous white rump patch. Female American Goldfinches are duller yellow overall than males, and lack black on the head. In winter, both sexes become duller yellow-brown on the back, head, and breast. The American Goldfinch breeds across much of the United States and southern Canada. In winter, northerly-breeding populations move south, expanding outside of this species’ breeding range into the coastal southeast, the southwest, northern Mexico, and the coast of California and Oregon. Birds breeding in the mid-latitudes migrate short distances, if at all. American Goldfinches breed in a variety of open habitats, including meadows, bushy fields, and (in modern times) urban and suburban yards. This species utilizes similar types of habitat in winter as it does in summer. American Goldfinches primarily eat seeds, including tree seeds and seeds of weedy groundcover plants. In appropriate habitat, American Goldfinches may be seen perched on the stalks of small plants while eating seeds from pods at the top. Goldfinches are also common feeder birds, and may be observed feeding in mixed groups of finches and other small songbirds. American Goldfinches are primarily active during the day.

Threat Status: Least Concern

  • American Goldfinch (Carduelis tristis). The Internet Bird Collection. Lynx Edicions, n.d. Web. 20 July 2012. .
  • Carduelis tristis. Xeno-canto. Xeno-canto Foundation, n.d. Web. 20 July 2012. .
  • McGraw, Kevin J. and Alex L. Middleton. 2009. American Goldfinch (Spinus tristis), The Birds of North America Online (A. Poole, Ed.). Ithaca: Cornell Lab of Ornithology; Retrieved from the Birds of North America Online: http://bna.birds.cornell.edu/bna/species/080
  • Peterson, Roger Tory. Birds of Eastern and Central North America. Boston: Houghton Mifflin, 1980. Print.
  • eBird Range Map - American Goldfinch. eBird. Cornell Lab of Ornithology, N.d. Web. 20 July 2012. .
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Institution

Supplier: DC Birds

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

American goldfinches are native to the Nearctic and widespread across most of North America. Their range extends as far north as Saskatchewan, Quebec and southwest Newfoundland during breeding seasons. They live year-round in middle latitudes of the United States, in the Pacific Northwest, Midwest, and eastern United States. They spend the winters in states farther south, from California to Mexico, along the Gulf Coast, and throughout Florida.

Biogeographic Regions: nearctic (Native )

  • Eastman, J. 1997. Birds of Forest, Yard & Thicket. Mechanicsburg, PA: Stackpole books.
  • McGraw, K., A. Middleton. 2009. "The Birds of North America online" (On-line). Accessed February 24, 2012 at http://bna.birds.cornell.edu/bna/species/080/articles/introduction.
  • Mobley, J. 2009. Birds of the World. Tarrytown, New York: Marshall Cavendish.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: Breeding range extends from southern Canada (southern British Columbia east to southwestern Newfoundland) south to southwestern California and northern Baja California, Arizona, New Mexico, extreme northeastern Texas, northern Louisiana, northern Mississippi, central Alabama, central Georgia, and South Carolina (AOU 1998). Winter range extends from southern Canada and the northern United States south to northern Baja California, northern Sonora, New Mexico, Texas, the U.S. Gulf coast, and southern Florida (AOU 1998). See Prescott and Middleton (1990) for information on age and sex differences in winter distribution in eastern North America.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

The breeding range reaches as far north as Saskatchewan and continues across the whole of North America, with the southern limits being North Carolina in the east and northern California in the west. The wintering range extends across the entire continental United States, extending well into Mexico along the Gulf coast.

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

American goldfinches are small finches distinguished by the bright yellow color of males during the breeding season. They have yellow or gold feathers around their throat, upper back, and belly. Their wings, tails, and the tops of their heads are glossy black. A white spot is usually visible above the males' tail after molting and into their summer plumage. Adult females, juveniles, and males in the winter are colored olive brown above, blending to olive yellow below. Their wing feathers are dull brownish-black. American goldfinches weigh 11 to 20 g and have wingspans of 19 to 22 cm. They have sharp and conical pointy beaks used for eating seeds.

Range mass: 11 to 20 g.

Range length: 11 to 13 cm.

Range wingspan: 19 to 22 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes colored or patterned differently; male more colorful

Average basal metabolic rate: 0.4108 W.

  • Audubon, J. 1841. The Birds of America. Philadelpia: J.J. Audubon.
  • Clement, P., A. Harris, J. Davis. 2010. Finches and Sparrows. London: Christopher helm publishers.
  • Wilson, J. 2001. Common Birds of North America: An Expanded Guidebook. Minocqua, Wisconsin: Willow Creek Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

American goldfinches are small finches with small conical bills. They are olive brown above, blending to olive yellow below. Males have bright yellow throats and jet black wing feathers. Females do not have a bright coloring. Their wing feathers are dull brownish-black.

Range length: 11.4 to 12.8 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes colored or patterned differently; male more colorful

Average mass: 13.6 g.

Average basal metabolic rate: 0.4108 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 13 cm

Weight: 13 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

American goldfinches are widely distributed on the edges of many forests and plains. They prefer weedy fields and floodplains. These habitats include early successional growth areas, cultivated lands, roadsides, orchards, and suburban gardens. They inhabit areas that are overgrown and filled with brush. Areas with high concentrations of thistles, asters, and other deciduous plants often attract them.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: savanna or grassland ; chaparral ; forest ; scrub forest

Other Habitat Features: suburban ; agricultural ; riparian

  • Fenimore, B. 2008. Backyard Birds of Pennsylvania. Layton, Utah: Gibbs Smith.
  • Middleton, A. 1979. Influence of age and habitat on reproduction by the American goldfinch. Ecology, 60/2: 418-432.
  • Peterson, R., L. Peterson. 2008. Peterson Field Guide to Birds of North America. New York: Houghton Mifflin company.
  • Semenchuck, G. 1992. The Atlas of Breeding Birds of Alberta. Alberta: Federation of Alberta Naturalist.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: American goldfinches are associated with weedy fields, cultivated lands, open deciduous and riparian woodland, forest edge, second growth, shrubbery, orchards, and farmlands (AOU 1998). Nests usually are in small trees or bushes, 0.3-10 meters above ground, sometimes in thistles near the ground ( Terres 1980). See Watt and Dimberio (1990) for information on the structure of successful nests.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

American goldfinches prefer weedy fields and flood plains in their breeding range. These habitats include early successional growth, cultivated lands, roadsides, orchards, and gardens. This habitat preference is maintained during the spring and fall migration. Winter habitats vary more than summer habitats, with finches moving near to human feeders (if available) in the northern part of their range. In the southern parts of their range, they tend to remain in habitats that closely approximate the weedy fields and flood plains of the north.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: savanna or grassland ; scrub forest

Other Habitat Features: suburban ; agricultural ; riparian

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Northern populations are migratory, whereas southern breeders are year-round residents. Overall, migrations peak from mid-April to early June and from late October to mid-December; specific timing varies across the large range.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

American goldfinches are granivores, mainly eating seeds, weeds, and sometimes pine cones. They mainly feed on grass seeds, thistle, and other low-growing herbaceous seeds. They often eat seeds while perched on top of a plant but also do so from the ground. In the winter, when naturally growing food is less prevalent, the birds often rely on feeders in parks or backyards. They occasionally eat insects if encountered.

Animal Foods: insects

Plant Foods: seeds, grains, and nuts

Primary Diet: herbivore (Granivore )

  • Bonta, M. 1994. Appalachian Autumn. United States: University of Pittsburgh Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Feeds on seeds (e.g., birches, alders, conifers, thistles, goldenrod, etc.); eats some berries and insects (Terres 1980). Young fed partly digested, regurgitated seeds.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

American goldfinches consume many different types of seeds from annual plants. Analysis of the stomach contents of one goldfinch showed 50 different items, only 3 of which were insects. The others included a wide variety of "weed" seeds, such as seeds from grasses and trees (alder, birch, cedar, elm, etc.) Goldfinches are well adapted to hanging on seed heads, and they prefer this to feeding on the ground. Goldfinches drink by obtaining a mouthful of water and quickly tipping the head back to swallow.

Animal Foods: insects

Plant Foods: seeds, grains, and nuts

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Because the diet of American goldfinches consists of seeds and nuts, they help in the dispersal of seeds.

Brown-headed cowbirds (Molothrus ater) parasitize American goldfinch nests. Parasitism rates of 9.4% were reported in 1979, but no brown-headed cowbirds successfully fledged from American goldfinch nests. Documented internal parasites include avian trichomoniasis (Trichomonas gallinae) and a protozoan parasite (Eimeriidae) reported to cause intestinal coccidiosis.

Ecosystem Impact: disperses seeds

Commensal/Parasitic Species:

  • brown-headed cowbirds (Molothrus ater)
  • avian trichomoniasis (Trichomonas gallinae)
  • intestinal coccidiosis (Eimeriidae)

  • Mansfield-Jones, J. 1995. Impact of intestinal coccidiosis on the American goldfinch, Carduelis tristis. Ann Arbor, Michigan: University of Michigan, Dissertation, 592 pp..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Common predators of American goldfinches are blue jays (Cyanocitta cristata), eastern garter snakes (Thamnophis sirtalis), American kestrels (Falco sparverius), and weasels (Mustela). Domestic and feral cats (Felis catus) also prey on them. They have a defense call, but otherwise are usually non-aggressive towards their predators.

Known Predators:

  • eastern garter snakes Thamnophis sirtalis
  • blue jays Cyanocitta cristata
  • weasels Mustela
  • American kestrels Falco sparverius
  • domestic and feral cats Felis catus

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecosystem Roles

American goldfinch nests are sometimes parasitized by Molothrus ater, resulting in a loss of goldfinch eggs and young. However, cowbird young are not successfully fledged from American goldfinch nests.

Commensal/Parasitic Species:

  • brown-headed cowbirds (Molothrus_ater)
  • louse flies (Hippoboscidae)
  • feather mites (Acari)
  • coccidia (Isospora)
  • Schistosoma_dermatitis

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Although predation at the nest is a common cause of nest failure, American goldfinches are surprisingly non-aggressive towards predators. American goldfinches display little aggressive behavior, other than alarm calling.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Carduelis tristis (red-eyed vireo, yellow warbler, gold finch, catbird, brown thrasher, towhee, robin) is prey of:
Accipiter striatus
Accipiter cooperii

Based on studies in:
Canada: Manitoba (Forest)

This list may not be complete but is based on published studies.
  • R. D. Bird, Biotic communities of the Aspen Parkland of central Canada, Ecology, 11:356-442, from p. 406 (1930).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Carduelis tristis (red-eyed vireo, yellow warbler, gold finch, catbird, brown thrasher, towhee, robin) preys on:
Insecta

Based on studies in:
Canada: Manitoba (Forest)

This list may not be complete but is based on published studies.
  • R. D. Bird, Biotic communities of the Aspen Parkland of central Canada, Ecology, 11:356-442, from p. 406 (1930).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Except during the breeding season, usually travels and forages in flocks.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

American goldfinches primarily communicate with each other by songs and calls. They exhibit 6 different types of calls: contact calls, threat cries, alarm and distress cries, courtship and pre-coition calls, feeding calls, and songs. Contact calls, described as "tsee-tsi-tsi-tsit" or "po-ta-to-chip," are the most common. Their song is also common during the breeding season, and described as "rambling" or "warbling." They make calls both while perched and in flight. After hatching, the adolescent American goldfinches will demonstrate a begging call when they are hungry. When they feel distressed or threatened, they have another distinctive call. They also communicate when attracting mates through their feather coloring and by flying displays.

Communication Channels: visual ; acoustic

Other Communication Modes: choruses

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

American goldfinches can live 7 to 10 years in the wild, but typically live 3 to 6 because of predation. The oldest known individual in the wild lived to be 10 years and 5 months old. Males tend to live longer than females.

Average lifespan

Status: wild:
11 hours.

Typical lifespan

Status: wild:
3 to 10.4 years.

  • de Magalhaes, J., J. Costa. 2009. A database of vertebrate longevity records and their relation to other life-history traits. Journal of Evolutionary Biology, 22/8: 1770-1774.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan/Longevity

American goldfinches have been recorded living up to 11 years in the wild and in captivity.

Range lifespan

Status: wild:
13 (high) years.

Range lifespan

Status: captivity:
11 (high) years.

Average lifespan

Status: wild:
125 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 13 years Observations: Breeds in the first year of life and annually thereafter (http://bna.birds.cornell.edu/)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Pair formation occurs in winter. Males attract mates using not only their bright plumage, but also by showing off to the female through flight routines. Females choose one male to mate with that will stay close to the nest. They are usually monogamous, but sometimes females will mate with more than one male. American goldfinches mate one time per season, but a few reports of 2 clutches per season have also been documented.

Mating System: polygynous

American goldfinches generally begin nesting in late June or early July, later than many closely-related species. They build their nests a few feet off the ground from twigs and branches found in nearby trees and shrubs. Females lay 2 to 7 eggs per clutch. Females incubate the eggs for an average of 15 days while males bring food to the nest and feed females via regurgitation. Newborn American goldfinches are usually naked or have hardly any feathers and weigh an average of 1 g. After the chicks hatch, males take on most of the responsibility for looking after the chicks. Females chase intruders away from the nest, forage, and return to feed the chicks through regurgitation. After 8 days, chicks are technically independent. They can fly in an average of 14 days, but this can be as few as 11 or as many as 17. Even after leaving the nest, chicks tend to return and are dependent on their parents for roughly 3 or 4 additional weeks. They are sexually mature at 11 months.

Breeding interval: American goldfinches generally breed once a year, but can breed up to 3 times.

Breeding season: Their breeding season is usually in late June and early July but can be as late as August or September.

Range eggs per season: 2 to 7.

Average time to hatching: 15 days.

Range fledging age: 11 to 17 days.

Range time to independence: 1 (low) weeks.

Average time to independence: 6 weeks.

Average age at sexual or reproductive maturity (female): 11 days.

Average age at sexual or reproductive maturity (male): 11 days.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Average time to hatching: 13 days.

Average eggs per season: 5.

Females lay the eggs and incubate them for 2 weeks until hatching. Once the chicks hatch, females leave the nest more frequently and males take care of feeding the chicks. Males defend the territory of their mates by singing different types of defense calls.

Parental Investment: altricial ; male parental care ; female parental care ; pre-hatching/birth (Provisioning: Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Protecting: Male, Female)

  • Audubon, J. 1841. The Birds of America. Philadelpia: J.J. Audubon.
  • Knight, R., S. Temple. 2006. Nest defense in the American goldfinch. Animal Behavior, 34/3: 887-897.
  • Marsh, R., W. Dawson. 1986. Winter fattening in the American goldfinch and the possible role of temperature in its regulation. Physiological Zoology, 59: 357-368.
  • McGraw, K., A. Middleton. 2009. "The Birds of North America online" (On-line). Accessed February 24, 2012 at http://bna.birds.cornell.edu/bna/species/080/articles/introduction.
  • Mobley, J. 2009. Birds of the World. Tarrytown, New York: Marshall Cavendish.
  • Rosen, R., K. Tarvin. 2006. Sexual signals of the male American goldfinch. Ethology, 112/10: 1008-1019.
  • Semenchuck, G. 1992. The Atlas of Breeding Birds of Alberta. Alberta: Federation of Alberta Naturalist.
  • Soffer, R. 1997. Learning about Birds. Moneola, N.Y.: Dover publications inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Nesting occurs relatively late for a songbird. In most areas, egg laying occurs primarily in late June, July, and August, sometimes in May or into September, with a peak in June and July, but some populations in California and Baja California nest from April to early July. Clutch size is 4-6 (usually 5). Incubation lasts 12-14 days. Young leave the nest about 11-17 days after hatching. Young depend on one or both parents for food for about 3 weeks after fledging.

Brown-headed cowbirds are brood parasites that sometimes lay eggs in American goldfinch nests. However, the cowbird young rarely survive. Probably this is because goldfinches feed mostly seeds to their nestlings, and this diet is inadequate for cowbird development.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

American goldfinches form mated pairs in the winter, although they don't start to breed until spring or early summer.

Breeding begins in late June or early July. The male watches attentively as the female builds the nest. The nest building takes her about six days. From 2 to 7 eggs are laid, often at night. Nesting success varies depending on the experience of the parents. In one study, experienced parents successfully raised 3.4 young per clutch and inexperienced parents raised 2.8 young per clutch. The female then incubates the eggs for 12 to 14 days before hatching. and the male feeds her. The female may leave with the male for short periods of a few minutes.

American goldfinches breed for the first time in the year after they hatch.

Breeding interval: American goldfinches may lay up to 3 clutches each year.

Breeding season: Breeding begins in late June or July.

Range time to hatching: 12 to 14 days.

Average age at sexual or reproductive maturity (female): 11 months.

Average age at sexual or reproductive maturity (male): 11 months.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Average eggs per season: 5.

American goldfinch young hatch naked, with reddish bodies and eyes closed. They develop quickly, opening their eyes by day three and fully opening them by day seven.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Carotenoids create yellow color: American goldfinch
 

The feathers of the American goldfinch appear yellow in color due to carotenoids.

     
  "The coloration of feathers can be caused by carotenoids (usually producing yellow, orange and red), melanins (usually producing brown, black and grey), other pigments (such as found in some parrot feathers) or by nano-scale reflective tissues (usually producing UV-blue, white and iridescent coloration; Gill 1995). Coloration produced by the latter mechanism is typically referred to as 'structural coloration.'" (Shawkey and Hill 2005:121)
  Learn more about this functional adaptation.
  • Shawkey, M. D.; Hill, G. E. 2005. Carotenoids need structural colours to shine. Biology Letters. 1(2): 121-124.
  • Shawkey, MD; Hill, G.E.; McGraw, K.J.; Hood, W.R.; Huggins, K.L. 2006. An experimental test of the relative contribution and condition-dependence of microstructure and carotenoids in yellow plumage coloration. Proceedings of the Royal Society of London B. 273: 2985-2991.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Carduelis tristis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 17 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNCCTATACCTAATTTTCGGCGCATGAGCCGGAATAGTAGGTACCGCCCTAAGCCTTCTCATCCGAGCAGAACTAGGTCAACCCGGAGCCCTCCTAGGAGACGACCAAGTCTACAACGTAATCGTCACGGCCCATGCTTTCGTTATAATCTTCTTCATAGTTATACCCATCATAATCGGAGGATTCGGAAACTGACTAGTTCCTCTAATGATCGGAGCCCCAGACATAGCATTCCCACGAATAAATAACATAAGCTTCTGACTACTTCCCCCATCATTCCTCCTCCTACTAGCATCTTCCACCGTAGAAGCAGGTGTTGGTACAGGCTGAACAGTATACCCTCCACTAGCTGGTAACCTAGCTCATGCCGGAGCTTCAGTTGACTTAGCAATTTTCTCCCTACACTTAGCCGGTATCTCTTCAATCCTAGGCGCAATCAACTTCATTACAACAGCAATCAATATAAAACCCCCTGCCCTATCACAATACCAAACTCCCCTATTCGTTTGATCAGTCCTAATTACTGCAGTACTCCTGCTCCTCTCCCTCCCAGTCCTTGCTGCAGGAATTACAATACTTCTCACAGACCGCAACCTCAACACCACTTTCTTCGATCCTGNAGGAGGAGGTGACCCANTCCTATACCAACACCTCTTCTGATTCTTTGGACATCCAGAAGTATATATCCTCATTCTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Carduelis tristis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 17
Specimens with Barcodes: 18
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5