Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Rhipidura dahli

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CCTATACCTCATCTTCGGTGCATGAGCCGGAATAGTTGGTACCGCCCTAAGCCTCCTCATTCGAGCAGAACTGGGACAACCAGGTGCTCTTCTAGGAGACGACCAAATCTACAACGTAGTTGTTACAGCCCATGCCTTTGTAATAATCTTCTTCATAGTTATACCTATTATAATCGGAGGGTTCGGAAACTGACTAGTCCCCCTAATAATTGGTGCCCCAGACATAGCATTCCCACGAATAAACAATATAAGCTTCTGACTGCTCCCTCCATCATTCCTGCTCCTACTAGCTTCCTCAACAGTAGAAGCAGGGGTAGGCACAGGATGAACTGTATATCCCCCATTAGCTGGAAACCTAGCCCATGCCGGAGCTTCAGTAGACCTAGCAATCTTTTCACTGCATCTAGCAGGAATCTCCTCTATCCTCGGAGCAATCAACTTCATCACAACAGCAATCAATATAAAACCTCCCGCATTATCACAATATCAAACTCCCCTATTCGTATGATCCGTCCTAATCACTGCAGTCCTACTACTTCTATCACTCCCTGTCCTTGCTGCCGGGATCACTATGCTCCTTACAGACCGTAACCTAAACACTACATTCTTCGACCCAGCTGGAGGAGGAGACCCAGTACTGTACCAACACCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Rhipidura dahli

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
Although this species may have a restricted range, it is not believed to approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5