Articles on this page are available in 1 other language: Spanish (13) (learn more)

Overview

Brief Summary

Setophaga citrina

A medium-sized (5 ½ inches) wood warbler, the male Hooded Warbler is most easily identified by its olive-green back, yellow breast and face, and black head and throat connected by solid black neck stripes. Female Hooded Warblers are similar to males, but lack much of the black on the head and throat. The male Hooded Warbler may be distinguished from the similarly-colored Wilson’s Warbler (Cardellina pusilla) by that species’ yellow throat, whereas the female Hooded Warbler may be distinguished from the female Wilson’s Warbler by that species’ lighter head and pale yellow eye-stripes. The Hooded Warbler breeds across much of the eastern United States and extreme southern Canada. Within that range, this species is mostly or completely absent from the southern half of Florida, New England, and parts of the upper Midwest. In winter, Hooded Warblers may be found in the West Indies, southern Mexico, and the Caribbean coast of Central America. Hooded Warblers breed in deciduous forest habitats, preferring woodland with small openings and shrubby edge habitats to dense forest. In winter, this species may be found in undergrowth and edge habitats in tropical forest as well as in overgrown fields. Hooded Warblers primarily eat small invertebrates, including insects and spiders. In appropriate habitat, Hooded Warblers may be observed foraging for insects on leaves, twigs, and branches on the ground or in the undergrowth. Birdwatchers may also listen for this species’ song, a whistled “chi chi chi chi chi chet chet.” Hooded Warblers are primarily active during the day, but, like many migratory songbirds, this species migrates at night.

Threat Status: Least Concern

  • Chiver, Ioana, L. J. Ogden and B. J. Stutchbury. 2011. Hooded Warbler (Setophaga citrina), The Birds of North America Online (A. Poole, Ed.). Ithaca: Cornell Lab of Ornithology; Retrieved from the Birds of North America Online: http://bna.birds.cornell.edu/bna/species/110
  • Hooded Warbler (Wilsonia citrina). The Internet Bird Collection. Lynx Edicions, n.d. Web. 20 July 2012. .
  • Peterson, Roger Tory. Birds of Eastern and Central North America. Boston: Houghton Mifflin, 1980. Print.
  • Wilsonia citrina. Xeno-canto. Xeno-canto Foundation, n.d. Web. 20 July 2012. .
  • eBird Range Map - Hooded Warbler. eBird. Cornell Lab of Ornithology, N.d. Web. 20 July 2012. .
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Institution

Supplier: DC Birds

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Wilsonia citrina is generally found in the midwestern and eastern parts of the United States. The western boundary extends north from east Texas to central Wisconsin, and on the east can be found from western New York and Connecticut down to northern Florida. The hooded warbler generally migrates to Southern Mexico and Central America for the winters. (Johns, 2000)

Biogeographic Regions: nearctic (Native ); neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (20,000-2,500,000 square km (about 8000-1,000,000 square miles)) BREEDING: extreme southeastern Nebraska (rarely) east to southern Michigan, southern Ontario, and southern New England; south to eastern Texas, Gulf Coast, and northern Florida peninsula; and west to eastern Kansas and eastern Oklahoma (AOU 1983). NON-BREEDING: lowlands from central Veracruz and southern Oaxaca south, including Yucatan Peninsula, through Belize, Guatemala, and Honduras; rarer on Pacific slope than on Atlantic, and rare as far south as Panama. Irregular in West Indies, most noticeably during migration (uncommon in Puerto Rico and the Virgin Islands) (Raffaele 1983). Rare in northern Colombia, northern Venezuela, Trinidad, Netherlands Antilles (Ridgely and Tudor 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Wilsonia citrina is generally found in the midwestern and eastern parts of the United States. The western boundary extends north from east Texas to central Wisconsin, and on the east can be found from western New York and Connecticut down to northern Florida. The hooded warbler generally migrates to Southern Mexico and Central America for the winters. (Johns, 2000)

Biogeographic Regions: nearctic (Native ); neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

E US; winters Mexico to Panama.
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

The upper tail and back are an olive-brown color, with the underside of the tail having white feathers. Both male and female birds have a black face with yellow around the eyes, but the coloring on the male is more drastic and distinctive compared to the shaded colors of the female. Wilsonia citrina also has yellow on the underside of the body and pink legs. (Robbins, et al., 1966)

Range mass: 10 to 11 g.

Average length: 12.5 cm.

Other Physical Features: endothermic ; bilateral symmetry

Average basal metabolic rate: 0.21538 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

The upper tail and back are an olive-brown color, with the underside of the tail having white feathers. Both male and female birds have a black face with yellow around the eyes, but the coloring on the male is more drastic and distinctive compared to the shaded colors of the female. Wilsonia citrina also has yellow on the underside of the body and pink legs. (Robbins, et al., 1966)

Range mass: 10 to 11 g.

Average length: 12.5 cm.

Other Physical Features: endothermic ; bilateral symmetry

Average basal metabolic rate: 0.21538 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 13 cm

Weight: 11 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wilsonia citrina generally nests in gaps in heavily forested areas, but stays away from the edge of the forest. Wilsonia citrina picks sites that have a well developed understory to build the nest in. The male and female prefer different habitats during the winter months. Males still prefer forested areas while females will take up in brushy fields and shrubby areas (Johns, 2000).

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: forest ; scrub forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: BREEDING: nests in understory of deciduous forest, especially along streams and ravine edges, and thickets in riverine forests (AOU 1983). Inhabits both young and mature forests but is most abundant in the latter. A dense shrub layer and scant ground cover are important. In North Carolina, common in mountain ravines with dense growth of mountain laurel (KALMIA LATIFOLIA) and rhododendron (RHODODENDRON spp.) and in bottomland swamps with dense pepperbush (CLETHRA ALNIFOLIA) and giant cane (ARUNDINARIA GIGANTEA) (LeGrand, pers. comm.). Generally favors large tracts of uninterrupted forest, but sometimes nests in forest patches as small as 5 ha, probably where these are close to larger forested areas. Nest placed in sapling or shrub in dense deciduous undergrowth, usually between 0.3 - 1.5 m. Individuals often return to the same area to nest in successive years (males are more likely to do so than females).

NON-BREEDING: undergrowth of various wooded habitats, scrubby areas, and thickets (AOU 1983). On winter range males occupy more mature forests than do females (Powell and Rappole 1986, Lynch et al. 1985); males use closed canopy forests, females use shrub or field habitats (Morton 1990). Older birds occupy higher quality habitat (Stutchbury 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wilsonia citrina generally nests in gaps in heavily forested areas, but stays away from the edge of the forest. Wilsonia citrina picks sites that have a well developed understory to build the nest in. The male and female prefer different habitats during the winter months. Males still prefer forested areas while females will take up in brushy fields and shrubby areas (Johns, 2000).

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: forest ; scrub forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

In fall, migrates over Gulf of Mexico (east to Greater Antilles). Departure from nesting areas occurs mainly from late July to late September. Begins to arrive in southern Mexico in mid-August, abundant there by late September. Arrival on the wintering grounds extends through late October or early November. In spring follows a more westerly route over the western Gulf and coastal plain of Mexico and Texas. Arrives in breeding areas generally from March or early April through mid-May. Recorded in South America October-April (Ridgely and Tudor 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Wilsonia citrina feeds primarily on small insects, spiders and other arthropods, either catching them while in flight or picking them off of forest vegetation (Johns, 2000).

Animal Foods: insects; terrestrial non-insect arthropods

Primary Diet: carnivore (Insectivore , Eats non-insect arthropods)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Eats wide variety of insects and spiders; gleans and flycatches in undergrowth, rarely moves more than 4.5 m above ground when foraging (Terres 1980, Powell and Rappole 1986). On breeding grounds, females seem to glean insects near ground while males hawk or sally to ground from elevated perch (Lynch et al. 1985). In winter in Mexico, foraged in open to fairly dense situations, 0-17 m above ground (average 2.7 m); most often hawked and sallied for flying insects.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Wilsonia citrina feeds primarily on small insects, spiders and other arthropods, either catching them while in flight or picking them off of forest vegetation (Johns, 2000).

Animal Foods: insects; terrestrial non-insect arthropods

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

While this species feeds on small insects and arthropods, it is not clear that it plays a unique role in the ecosystem, or that its function would have any impact on the ecosystem if it were removed. It has been reduced dramatically in number in various Canadian forests, but there is no apparent effect on those forests (Whittam & McCracken, 1999).

Ecosystem Impact: creates habitat

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predators of W. citrina include snakes, racoons and cats. The largest danger comes from the possibility of running into man-made structures during the nocturnal migrations (Whittam & McCracken, 1999).

Known Predators:

  • domestic cats (Felis silvestris)
  • raccoons (Procyon lotor)
  • snakes (Serpentes)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecosystem Roles

While this species feeds on small insects and arthropods, it is not clear that it plays a unique role in the ecosystem, or that its function would have any impact on the ecosystem if it were removed. It has been reduced dramatically in number in various Canadian forests, but there is no apparent effect on those forests (Whittam & McCracken, 1999).

Ecosystem Impact: creates habitat

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Predators of Wilsonia citrina include snakes, racoons and cats. The largest danger comes from the possibility of running into man-made structures during the nocturnal migrations (Whittam & McCracken, 1999).

Known Predators:

  • domestic cats (Felis_silvestris)
  • raccoons (Procyon_lotor)
  • snakes (Serpentes)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Wilsonia citrina is prey of:
Serpentes
Procyon lotor
Felis silvestris

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Wilsonia citrina preys on:
non-insect arthropods
Arthropoda
Insecta

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Comments: See Page and Cadman (1994 COSEWIC report) for status in Canada.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Breeding territory size generally is about 0.5-0.75 ha. Males and females also maintain separate winter territories. Commonly returns to same winter territory in successive years (Powell and Rappole 1986, Rappole and Warner 1980); often joins mixed flocks within territory (Stiles and Skutch 1989). Breeding density may range up to 22 pairs per 40 ha.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

The hooded warbler has two modes of singing. One involves repeatedly singing the same pattern, and the other is an irregular mix of 3 or 4 different patterns. Singing is used by both the males and females in attracting mates. The repeat mode may be used for attracting the mate, while the irregular mode is some sort of method of "negotiating" with nearby warblers (Wiley, et al., 1994).

Communication Channels: visual ; acoustic

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Communication and Perception

The hooded warbler has two modes of singing. One involves repeatedly singing the same pattern, and the other is an irregular mix of 3 or 4 different patterns. Singing is used by both the males and females in attracting mates. The repeat mode may be used for attracting the mate, while the irregular mode is some sort of method of "negotiating" with nearby warblers (Wiley, et al., 1994).

Communication Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

The lifespan of W. citrina is about 8-9 years.

Average lifespan

Status: wild:
8 years.

Average lifespan

Status: wild:
98 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan/Longevity

The lifespan of Wilsonia citrina is about 8-9 years.

Average lifespan

Status: wild:
8 years.

Average lifespan

Status: wild:
98 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 8.2 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Both male and female W. citrina sing during the process of attracting a mate. While birds will form pairs for mating purposes, it is frequently found that a mother's eggs have been fertilized by a neighboring male (Johns, 2000).

Mating System: monogamous

The female constructs a nest in the underbrush of a low lying area. The nest is constructed of bark and plant material, with an outer layer of dead leaves. Three to five eggs are laid, then normally incubated for about twelve days before hatching. After hatching, the chicks will fledge in about eight or nine days and continue their growth into adult birds. Juvenile birds will be capable of reproduction the next breeding season.

Breeding season: April - June

Range eggs per season: 3 to 5.

Average time to hatching: 12 days.

Average fledging age: 9 days.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); oviparous

Average time to hatching: 12 days.

Average eggs per season: 3.

Males provide from 25% to 75% of feeding visits to young. Scientists had hypothesized that males that provide less parental care use their time and energy to seek matings with neighboring females instead. However, this turns out not to be the case. (Pitcher and Stutchbury, 2000)

Parental Investment: altricial ; male parental care ; female parental care

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

In most areas, nesting occurs mainly from mid- to late May through July. In Ohio, most clutches are completed from mid-May to mid-June (Peterjohn and Rice 1991). Clutch size three to four (rarely five). Incubation, by the female, lasts 12 days. Young are tended by both parents, leave nest in 8-9 days, fly 2-3 days later, remain with adults for several weeks. Sexually mature usually in one year.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Both male and female Wilsonia citrina sing during the process of attracting a mate. While birds will form pairs for mating purposes, it is frequently found that a mother's eggs have been fertilized by a neighboring male (Johns, 2000).

Mating System: monogamous

The female constructs a nest in the underbrush of a low lying area. The nest is constructed of bark and plant material, with an outer layer of dead leaves. Three to five eggs are laid, then normally incubated for about twelve days before hatching. After hatching, the chicks will fledge in about eight or nine days and continue their growth into adult birds. Juvenile birds will be capable of reproduction the next breeding season.

Breeding season: April - June

Range eggs per season: 3 to 5.

Average time to hatching: 12 days.

Average fledging age: 9 days.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); oviparous

Average time to hatching: 12 days.

Average eggs per season: 3.

Males provide from 25% to 75% of feeding visits to young. Scientists had hypothesized that males that provide less parental care use their time and energy to seek matings with neighboring females instead. However, this turns out not to be the case. (Pitcher and Stutchbury, 2000)

Parental Investment: altricial ; male parental care ; female parental care

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Wilsonia citrina

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATACCTGATTTTCGGCGCATGAGCCGGAATAGTGGGTACCGCCCTAAGCCTCCTCATTCGAGCAGAACTAGGCCAACCCGGAGCTCTTCTGGGAGACGACCAAGTCTATAACGTAGTTGTCACGGCCCATGCCTTCGTAATAATTTTCTTTATAGTCATGCCTATTATAATCGGAGGGTTTGGAAATTGACTAGTCCCCCTAATAATTGGAGCCCCAGATATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTACTCCCACCATCATTCCTCCTCCTCCTAGCATCTTCCACAGTTGAAGCAGGCGTAGGTACAGGCTGAACTGTGTACCCACCACTAGCCGGCAACCTAGCCCACGCCGGAGCCTCAGTCGACCTGGCAATCTTCTCCCTACACCTGGCCGGTATTTCCTCAATCCTCGGGGCAATTAACTTCATTACAACAGCAATTAATATGAAACCTCCTGCCCTCTCACAATATCAAACCCCTCTATTCGTCTGATCAGTCCTAATCACTGCAGTTCTCCTACTCCTTTCCCTCCCAGTCCTAGCTGCAGGAATCACAATGCTCCTCACAGACCGCAACCTCAACACCACATTCTTCGATCCTGCCGGAGGAGGAGATCCCGTCCTATATCAACATCTTTTCTGATTCTTCGGCCACCCAGAAGTCTACATCCTTATCCTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Wilsonia citrina

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5