Articles on this page are available in 1 other language: Spanish (7) (learn more)

Overview

Brief Summary

The Eastern Meadowlark is found in the eastern United States and adjacent Canada south through Mexico (except for Baja California and northwestern Mexico) to central Panama and in South America from northern and eastern Colombia, Venezuela, Guyana, and Surinam south, east of the Andes, to Amazonian Brazil. Except in the most northern part of the range, Eastern Meadowlarks are year-round residents. The Eastern Meadowlark is a bird of open fields and pastures, meadows, and prairies and populations in the eastern United States have declined in recent decades as acreage of these habitats has declined.

The diet of the Eastern Meadowlark consists mainly of insects and seeds.

The male Eastern Meadowlark defends his territory by singing, often from a fencepost or other raised perch. In courtship, the male faces the female, puffs out his chest feathers and points his bill straight up, prominently displaying the black "V" on his bright yellow underparts, and flicks his wings, sometimes even jumping into the air. Males may mate with more than one female.

The nest is built by the female on the ground in a small depression in dense grass. It is a domed structure made of grass stems with the entrance on the side, often with narrow trails leading through the grass to the nest. The 3 to 5 (sometimes as many as 7) eggs, which are white and heavily spotted with brown and purple, are incubated by the female for 13 to 15 days. Both parents (but especially the female) feed the nestlings, which leave the nest around 11 to 12 days, at which point they are still unable to fly and are tended by parents for at least two more weeks. Two broods per year are typical.

The Eastern Meadowlark is extremely similar to the Western Meadowlark (Sturnella neglecta) in color and pattern, but has a very different song. The two generally do not interbreed where their ranges overlap and hybrids are largely sterile (Lanyon 1979), but they do actively defend their territories against members of the other species. Birds in the dry desert grasslands of the southwestern United States and adjacent Mexico may represent a distinct species, referred to as Lilian's Meadowlark (S. lilianae) (Barker et al. 2008).

(Kaufman 1996; AOU 1998)

Creative Commons Attribution 3.0 (CC BY 3.0)

Supplier: Leo Shapiro

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) BREEDING: South Dakota and Minnesota east across southern Canada to New Brunswick and Nova Scotia, south through eastern United States and Middle America to central Panama and west to Nebraska, Colorado, Kansas, and Texas; Cuba; in South America from Colombia, Venezuela, Guyana, and Suriname south to Amazonian Brazil (Lanyon 1995, AOU 1998). NON-BREEDING: Texas, Kansas, Nebraska, Minnesota, Wisconsin, Michigan, Ontario, New York and New England south through breeding range (Lanyon 1995, AOU 1998). RESIDENT: central Arizona, central New Mexico, and western Texas south to Sonora and Chihuahua (AOU 1998).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Sturnella magna is found in the eastern United States, as well as parts of the southwest U.S. and Central America. The summer breeding range includes parts of southern Canada.

Biogeographic Regions: nearctic (Native ); neotropical (Native )

  • 1992. Eastern Meadowlark. Pp. 345 in R Zeleny, ed. The World Book Encyclopedia, Vol. 13. Chicago: World Book Inc..
  • Campbell, B. 1973. Sturnella magna. Pp. 337 in R Holmes, ed. The Dictionary of Birds in Color. New York: The Viking Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Sturnella_magna is found in the eastern United States, as well as parts of the southwest U.S. and Central America. The summer breeding range includes parts of southern Canada.

Biogeographic Regions: nearctic (Native ); neotropical (Native )

  • 1992. Eastern Meadowlark. Pp. 345 in R Zeleny, ed. The World Book Encyclopedia, Vol. 13. Chicago: World Book Inc..
  • Campbell, B. 1973. Sturnella magna. Pp. 337 in R Holmes, ed. The Dictionary of Birds in Color. New York: The Viking Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Eastern meadowlarks are medium-sized songbirds, with long, slender, light gray bills and dark brown eyes. The tails are short and have rigid rectrices. The legs and toes are long. Male S. magna have grayish heads with blackish stripes, a yellow “eyebrow”, and dark crowns with a median stripe. The wings and tail are streaked and barred with dark and light brown. Males have a broad white moustachial stripe and a yellow chin, which is divided from the underparts by a broad black breast band. The underparts turn off-white on the streaked flanks and under the tail coverts. The pale undertail coverts are streaked and spotted dusky black. Females are similar to males except that they are smaller, paler, and have a narrower breast band. Males are slightly larger than females, from 21 to 25 cm in length, females are from 19 to 23 cm. Juvenile eastern meadowlarks have masked black areas and the white areas are buffish. Juveniles also have more brown plumage in the winter. Eastern meadowlark eggs are white, speckled with reddish-brown. When these birds walk, the tail constantly jerks open. These birds fly by beating their wings vigorously and then gliding.

Range mass: 90 to 150 g.

Range length: 19 to 26 cm.

Range wingspan: 35 to 40 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger; sexes colored or patterned differently

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Eastern meadowlarks are medium-sized songbirds, with long, slender, light gray bills and dark brown eyes. The tails are short and have rigid rectrices. The legs and toes are long. Male S._magna have grayish heads with blackish stripes, a yellow “eyebrow”, and dark crowns with a median stripe. The wings and tail are streaked and barred with dark and light brown. Males have a broad white moustachial stripe and a yellow chin, which is divided from the underparts by a broad black breast band. The underparts turn off-white on the streaked flanks and under the tail coverts. The pale undertail coverts are streaked and spotted dusky black. Females are similar to males except that they are smaller, paler, and have a narrower breast band. Males are slightly larger than females, from 21 to 25 cm in length, females are from 19 to 23 cm. Juvenile eastern meadowlarks have masked black areas and the white areas are buffish. Juveniles also have more brown plumage in the winter. Eastern meadowlark eggs are white, speckled with reddish-brown. When these birds walk, the tail constantly jerks open. These birds fly by beating their wings vigorously and then gliding.

Range mass: 90 to 150 g.

Range length: 19 to 26 cm.

Range wingspan: 35 to 40 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger; sexes colored or patterned differently

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 24 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern meadowlarks breed in native grasslands, pastures, savannas, alfalfa and hay fields, cropland borders, roadsides, orchards, golf courses, airports, reclaimed strip mines, overgrown fields, and other open areas. In the western range, the breeding range also consists of tall-grass prairies and desert grassland. In the winter they are generally found in open country, cultivated fields, feedlots, and marshes. Eastern meadowlarks are generally found in habitats that are more mesic than their close relative, western meadowlarks (S. neglecta).

Habitat Regions: temperate ; tropical ; terrestrial

Terrestrial Biomes: savanna or grassland

Other Habitat Features: suburban ; agricultural

  • Elliott, L., M. Read. 1998. Common Birds And Their Tongs. Boston: Houghton Mifflin Company.
  • Lanyon, W. 1995. Eastern Meadowlark: Sturnella magna. Washington D. C.: American Ornithologists' Union.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Grasslands, savanna, open fields, pastures, cultivated lands, sometimes marshes. In southeastern Arizona, avoided recently burned grassland habitats (Southwest. Nat. 37:73). Nests on the ground in concealing herbage.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern meadowlarks breed in native grasslands, pastures, savannas, alfalfa and hay fields, cropland borders, roadsides, orchards, golf courses, airports, reclaimed strip mines, overgrown fields, and other open areas. In the western range, the breeding range also consists of tall-grass prairies and desert grassland. In the winter they are generally found in open country, cultivated fields, feedlots, and marshes. Eastern meadowlarks are generally found in habitats that are more mesic than their close relative, western meadowlarks (S._neglecta).

Habitat Regions: temperate ; tropical ; terrestrial

Terrestrial Biomes: savanna or grassland

Other Habitat Features: suburban ; agricultural

  • Elliott, L., M. Read. 1998. Common Birds And Their Tongs. Boston: Houghton Mifflin Company.
  • Lanyon, W. 1995. Eastern Meadowlark: Sturnella magna. Washington D. C.: American Ornithologists' Union.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Populations in northern part of breeding range are migratory; return north to nesting areas usually in early April, males arrive about 2 weeks prior to females (Terres 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Eastern meadowlarks walk and run on the ground while foraging for food, they also forage by probing beneath the soil. Their diet varies with the season. In the spring they feed mainly on cutworms, grubs, and caterpillars. When summer comes they eat insects, primarily beetles and grasshoppers. In the winter they eat noxious weed seeds and waste grains as well as some wildfruits and occasional carrion from road-kill or predator-kills.

Animal Foods: carrion ; insects

Plant Foods: seeds, grains, and nuts; fruit

Primary Diet: carnivore (Insectivore ); herbivore (Granivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Eats mainly insects and other small invertebrates, also grain and seeds; forages on the ground (Terres 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Eastern meadowlarks walk and run on the ground while foraging for food, they also forage by probing beneath the soil. Their diet varies with the season. In the spring they feed mainly on cutworms, grubs, and caterpillars. When summer comes they eat insects, primarily beetles and grasshoppers. In the winter they eat noxious weed seeds and waste grains as well as some wildfruits and occasional carrion from road-kill or predator-kills.

Animal Foods: carrion ; insects

Plant Foods: seeds, grains, and nuts; fruit

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Eastern meadowlarks are prey for larger predators and they prey on a variety of insects, including grubs and caterpillars, which could damage the surrounding vegetation. They also act to disperse the sees of plants they eat. Sturnella magna serves as a host for a variety of internal and external parasites, and for brown-headed cowbirds. Brown-headed cowbirds are obligate parasites, which lay eggs in the nests of other species of birds.

Ecosystem Impact: disperses seeds; biodegradation ; soil aeration

Commensal/Parasitic Species:

  • Microtetrameres sturnellae
  • Phthiraptera
  • Siphonaptera
  • brown-headed cowbirds (Molothrus ater)
  • Hippoboscidae

  • 2003. Western Meadowlark. Pp. 316 in M Hutchins, ed. Grzimek's Animal Life Encyclopedia, Vol. 11. Detroit: Gale Group Inc..
  • Cornell Lab of Ornithology. 2005. "Demography and Populations" (On-line). Birds of North America Online. Accessed November 19, 2005 at http://bna.birds.cornell.edu/BNA/account/Eastern_Meadowlark/DEMOGRAPHY_AND_POPULATIONS.html.
  • Stark, F. 1940. A study of the animal parasites of Sturnella magna magna and Sturnella neglecta of southeastern Kansas. Pittsburg, Kansas: Kansas State Teachers College.
  • Taylor, R. 1969. Histological study of host-parasite relations between meadowlarks (Sturnella) and Microtetrameres Sturnellae (Nematoda: Tetrameridae). Oklahoma: University of Oklahoma Graduate College.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern meadowlarks are preyed on by hawks and falcons and occasionally by owls. They are most likely to be preyed upon by owls during the owl’s breeding season. While the owls are raising their young, they are more likely to hunt during daylight hours, in order to catch enough prey to feed the chicks. Hawks and falcons are diurnal, and often hunt in similar habitats. During their nesting season, domestic cats, dogs, foxes, coyotes, and skunks prey upon the eggs and nestlings. Eastern meadowlark coloration helps them to blend in to their grassland surroundings, they can be difficult to spot unless they are on a high perch.

Known Predators:

  • domestic cats (Felis silvestris)
  • dogs (Canis lupus familiaris)
  • foxes (Vulpes)
  • skunks (Mephitidae)
  • hawks (Accipitridae)
  • falcons (Falconidae)
  • sometimes owls (Strigiformes)
  • coyotes (Canis latrans)

Anti-predator Adaptations: cryptic

  • Grossman, M., J. Hamlet. 1964. Birds of Prey of the World. New York: Bonanaza Books.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecosystem Roles

Eastern meadowlarks are prey for larger predators and they prey on a variety of insects, including grubs and caterpillars, which could damage the surrounding vegetation. They also act to disperse the sees of plants they eat. Sturnella_magna serves as a host for a variety of internal and external parasites, and for Molothrus ater. Brown-headed cowbirds are obligate parasites, which lay eggs in the nests of other species of birds.

Ecosystem Impact: disperses seeds; biodegradation ; soil aeration

Commensal/Parasitic Species:

  • Microtetrameres_sturnellae
  • Phthiraptera
  • Siphonaptera
  • brown-headed cowbirds (Molothrus_ater)
  • Hippoboscidae

  • 2003. Western Meadowlark. Pp. 316 in M Hutchins, ed. Grzimek's Animal Life Encyclopedia, Vol. 11. Detroit: Gale Group Inc..
  • Cornell Lab of Ornithology. 2005. "Demography and Populations" (On-line). Birds of North America Online. Accessed November 19, 2005 at http://bna.birds.cornell.edu/BNA/account/Eastern_Meadowlark/DEMOGRAPHY_AND_POPULATIONS.html.
  • Stark, F. 1940. A study of the animal parasites of Sturnella magna magna and Sturnella neglecta of southeastern Kansas. Pittsburg, Kansas: Kansas State Teachers College.
  • Taylor, R. 1969. Histological study of host-parasite relations between meadowlarks (Sturnella) and Microtetrameres Sturnellae (Nematoda: Tetrameridae). Oklahoma: University of Oklahoma Graduate College.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Eastern meadowlarks are preyed on by hawks and falcons and occasionally by owls. They are most likely to be preyed upon by owls during the owl’s breeding season. While the owls are raising their young, they are more likely to hunt during daylight hours, in order to catch enough prey to feed the chicks. Hawks and falcons are diurnal, and often hunt in similar habitats. During their nesting season, domestic cats, dogs, foxes, coyotes, and skunks prey upon the eggs and nestlings. Eastern meadowlark coloration helps them to blend in to their grassland surroundings, they can be difficult to spot unless they are on a high perch.

Known Predators:

  • domestic cats (Felis_silvestris)
  • dogs (Canis_lupus_familiaris)
  • foxes (Vulpes)
  • skunks (Mephitidae)
  • hawks (Accipitridae)
  • falcons (Falconidae)
  • sometimes owls (Strigiformes)
  • coyotes (Canis_latrans)

Anti-predator Adaptations: cryptic

  • Grossman, M., J. Hamlet. 1964. Birds of Prey of the World. New York: Bonanaza Books.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Comments: Number of occurrences has not been determined but considered common and widespread.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Comments: Highest BBS density reported for Kentucky, Misouri, and Kansas south through Oklahoma and Arkansas to Texas (41-64 birds per route). Lowest density reported for Maritime Provinces and New England (1-3 birds per route; Lanyon 1995).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Breeding territory of male is about 3 ha (Terres 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

The songs of S. magna are one of the first birdsongs of spring. Sturnella magna have a variety of vocal communications. There are begging notes, location notes, dzert, whistle, chatter, weet, primary song, flight song, female song, zeree, and tee-tee-tee. Nestlings and recently fledged juveniles use begging and location notes, which are simple high-pitched notes. These notes enable the parents to find and feed their young. The dzert call indicates mild disturbance. The whistle indicates intense excitement in males or females, such as the presence of a predator, just before a flight song, or immediately after an aerial chase or copulation. Both sexes use the chatter call to indicate excitement such as the presence of a predator or intruder. Females also chatter after copulation and in response to their mates’ primary song. Only males use the primary song, which sounds like seee-yeee, seee-yer. In the courtship period, female S. magna use the female song, during early morning preening. The alarm call of the eastern meadowlark is a short buzzy, dzert.

Posturing and aerial chases are used to attract and pursue possible mates. Jump-flights are used to ward off males that are intruding on another male’s territory. Bill-tilting and tail- and wing-flashing are used in territorial disputes, as is expansion posturing. Expansion posturing is when individuals extend their contour feathers, spread the tail, and draws the head close to the body. Female S. magna use expansion posturing to warn off its mate when the female is unreceptive. If expansion posturing does not succeed in warning off the male, the female will hold its feathers tight against its body and point its gaping bill at the male. Male eastern meadowlarks also use expansion posturing after the formation of the pair bond.

Communication Channels: visual ; acoustic

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Communication and Perception

The songs of S._magna are one of the first birdsongs of spring. Sturnella_magna have a variety of vocal communications. There are begging notes, location notes, dzert, whistle, chatter, weet, primary song, flight song, female song, zeree, and tee-tee-tee. Nestlings and recently fledged juveniles use begging and location notes, which are simple high-pitched notes. These notes enable the parents to find and feed their young. The dzert call indicates mild disturbance. The whistle indicates intense excitement in males or females, such as the presence of a predator, just before a flight song, or immediately after an aerial chase or copulation. Both sexes use the chatter call to indicate excitement such as the presence of a predator or intruder. Females also chatter after copulation and in response to their mates’ primary song. Only males use the primary song, which sounds like seee-yeee, seee-yer. In the courtship period, female S._magna use the female song, during early morning preening. The alarm call of the eastern meadowlark is a short buzzy, dzert.

Posturing and aerial chases are used to attract and pursue possible mates. Jump-flights are used to ward off males that are intruding on another male’s territory. Bill-tilting and tail- and wing-flashing are used in territorial disputes, as is expansion posturing. Expansion posturing is when individuals extend their contour feathers, spread the tail, and draws the head close to the body. Female S._magna use expansion posturing to warn off its mate when the female is unreceptive. If expansion posturing does not succeed in warning off the male, the female will hold its feathers tight against its body and point its gaping bill at the male. Male eastern meadowlarks also use expansion posturing after the formation of the pair bond.

Communication Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Eastern meadowlarks have an expected lifespan of five years in the wild, which is the same as the high end of its expected lifespan in captivity. The longest know lifespan in the wild is nine years.

Range lifespan

Status: wild:
9 (high) years.

Average lifespan

Status: wild:
5 years.

Typical lifespan

Status: captivity:
3 to 5 years.

Average lifespan

Status: wild:
151 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan/Longevity

Eastern meadowlarks have an expected lifespan of five years in the wild, which is the same as the high end of its expected lifespan in captivity. The longest know lifespan in the wild is nine years.

Range lifespan

Status: wild:
9 (high) years.

Average lifespan

Status: wild:
5 years.

Typical lifespan

Status: captivity:
3 to 5 years.

Average lifespan

Status: wild:
151 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 12.6 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Male eastern meadowlarks are polygynous, with most males having two to three mates. Female S. magna have only one mate per breeding season, provided that the male successfully defends the territory. Males establish their territories approximately two to four weeks before females arrive. Male S. magna display their territories with flight displays and by singing. Female eastern meadowlarks choose their mates by selecting territories, which are defended by males with conspecific vocalizations. Once the pair bond forms the pair remains close together while foraging and searching for nest sites. A male S. magna defends its territory against rivals by fluffing out its plumage and pointing its bill upwards. Males guard their mates from neighboring males by constantly guarding their mate.

Males establish their territories in March, females arrive about two to four weeks later females. Male eastern meadowlarks rarely engage in body contact and fighting when defending their territories, however, when it does occur it can be quite severe. Pairing occurs immediately after females arrive. The "aerial chase" occurs within minutes of a female choosing a male. The female typically initiates the chase, although sometimes the chase includes two females and one male. The aerial chase consists of either a series of short flights or as brief flights interspersed with periods of posturing and rest. Additionally, the male is typically silent during the aerial chase. These chases usually carry the participants well beyond the boundaries of the male’s territory. When a female eastern meadowlark is receptive, she eventually assumes the receptive posture, at which time the male will approach, paw the female’s back and then mount. Afterwards the female remains in a semi-receptive position and flutters and shakes its plumage, chatters several times, then vigorously preens itself. The female receptive posture consists of the female elevating its bill and tail, holding its wings slightly drooped, and quivering, sometimes the female also chatters. Later on in the breeding season "jump-flights" and tee-tee-tee calls may accompany the receptive posture. However, if a male approaches when the female is not receptive, the female will use "expansion posturing" to warn off the male. Also, males and females make jump-flights before and during repeated copulation periods. A jump-flight consists of the bird jumping approximately one meter into the air and then flying several meters. Once the breeding season is over, male S. magna cease defending their territories.

Mating System: polygynous

Female eastern meadowlarks gather nest materials and build the nest. The nest consists of coarse grasses, lined with finer grasses and is constructed on the ground, typically in a shallow depression. The outside diameter of the nest ranges from 14-21 cm, the inside diameter ranges from 8-15 cm, and the inside depth ranges from 5-8 cm. Female S. magna land a distance away from the nest and then stealthily approach the nest.

Breeding interval: Breeding first occurs in late May, with a second brood produced in late June to early July.

Breeding season: Breeding occurs from late May to August.

Range eggs per season: 6 to 14.

Range time to hatching: 13 to 15 days.

Range fledging age: 11 to 12 days.

Range time to independence: 2 (low) weeks.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Average eggs per season: 5.

Females incubate the eggs for 13 to 15 days, when the altricial young hatch. After the eggs hatch both the female and her mate feed the hatchlings. However, females do most of the feeding. Nestlings typically fledge 11 to 12 days after hatching, but juveniles do not become independent for at least another two weeks. The parents continue to feed the fledglings until they become independent.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Female); pre-independence (Provisioning: Male, Female, Protecting: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Clutch size 3-7 in north (commonly 5); larger in north than in south). Usually 2 broods per year in north. Incubation 13-15 days, by female. Young tended mainly by female; male may take over feeding of fledged young while female renests. In Ontario, 2/3 of nesting females were polygynously mated (Knapton 1988). In pairs or family groups most of year (Stiles and Skutch 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Male eastern meadowlarks are polygynous, with most males having two to three mates. Female S._magna have only one mate per breeding season, provided that the male successfully defends the territory. Males establish their territories approximately two to four weeks before females arrive. Male S._magna display their territories with flight displays and by singing. Female eastern meadowlarks choose their mates by selecting territories, which are defended by males with conspecific vocalizations. Once the pair bond forms the pair remains close together while foraging and searching for nest sites. A male S._magna defends its territory against rivals by fluffing out its plumage and pointing its bill upwards. Males guard their mates from neighboring males by constantly guarding their mate.

Males establish their territories in March, females arrive about two to four weeks later females. Male eastern meadowlarks rarely engage in body contact and fighting when defending their territories, however, when it does occur it can be quite severe. Pairing occurs immediately after females arrive. The "aerial chase" occurs within minutes of a female choosing a male. The female typically initiates the chase, although sometimes the chase includes two females and one male. The aerial chase consists of either a series of short flights or as brief flights interspersed with periods of posturing and rest. Additionally, the male is typically silent during the aerial chase. These chases usually carry the participants well beyond the boundaries of the male’s territory. When a female eastern meadowlark is receptive, she eventually assumes the receptive posture, at which time the male will approach, paw the female’s back and then mount. Afterwards the female remains in a semi-receptive position and flutters and shakes its plumage, chatters several times, then vigorously preens itself. The female receptive posture consists of the female elevating its bill and tail, holding its wings slightly drooped, and quivering, sometimes the female also chatters. Later on in the breeding season "jump-flights" and tee-tee-tee calls may accompany the receptive posture. However, if a male approaches when the female is not receptive, the female will use "expansion posturing" to warn off the male. Also, males and females make jump-flights before and during repeated copulation periods. A jump-flight consists of the bird jumping approximately one meter into the air and then flying several meters. Once the breeding season is over, male S. magna cease defending their territories.

Mating System: polygynous

Female eastern meadowlarks gather nest materials and build the nest. The nest consists of coarse grasses, lined with finer grasses and is constructed on the ground, typically in a shallow depression. The outside diameter of the nest ranges from 14-21 cm, the inside diameter ranges from 8-15 cm, and the inside depth ranges from 5-8 cm. Female S. magna land a distance away from the nest and then stealthily approach the nest.

Breeding interval: Breeding first occurs in late May, with a second brood produced in late June to early July.

Breeding season: Breeding occurs from late May to August.

Range eggs per season: 6 to 14.

Range time to hatching: 13 to 15 days.

Range fledging age: 11 to 12 days.

Range time to independence: 2 (low) weeks.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Average eggs per season: 5.

Females incubate the eggs for 13 to 15 days, when the altricial young hatch. After the eggs hatch both the female and her mate feed the hatchlings. However, females do most of the feeding. Nestlings typically fledge 11 to 12 days after hatching, but juveniles do not become independent for at least another two weeks. The parents continue to feed the fledglings until they become independent.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Female); pre-independence (Provisioning: Male, Female, Protecting: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Sturnella magna

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNNCTATACTTAATTTTTGGCGCATGGGCCGGAATAGTTGGTACTGCCCTAAGCCTCCTCATCCGAGCAGAACTAGGACAACCTGGAGCCCTTCTAGGAGACGACCAAGTATACAACGTAGTCGTCACAGCTCATGCTTTCGTAATAATCTTCTTCATAGTCATACCAATCATAATCGGAGGATTCGGAAACTGACTAGTACCCCTAATAATTGGAGCCCCAGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGGCTACTCCCCCCATCCTTCCTCCTCCTTCTAGCATCCTCCACAGTCGAAGCAGGAGTAGGAACAGGATGGACAGTGTACCCCCCACTAGCAGGCAACCTAGCCCACGCCGGAGCCTCAGTCGACCTAGCAATTTTCTCCCTACATTTAGCCGGTATCTCCTCAATCCTAGGGGCAATCAACTTCATTACAACAGCAATTAACATAAAACCACCCGCCCTATCACAATACCAAACCCCCCTATTCGTCTGATCCGTCCTAATCACTGCAGTCCTTTTACTACTCTCCCTTCCAGTTCTTGCCGCAGGCATCACAATGCTCCTCACAGACCGCAACCTTAACACCACATTCTTTGACCCCGCCGGAGGCGGAGATCCTGTATTATACCAACACCTTTTTTGATTCTTCGGCCACCCAGAAGTCTACATCTTAATCCTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Sturnella magna

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • Least Concern (LC)
  • Not Recognized (NR)
  • Not Recognized (NR)
  • Not Recognized (NR)
  • Not Recognized (NR)
  • Not Recognized (NR)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5