Articles on this page are available in 1 other language: Spanish (8) (learn more)

Overview

Brief Summary

Pheucticus ludovicianus

A medium-sized (7-8 ½ inches) songbird, the male Rose-breasted Grosbeak is most easily identified by its black head and body, white belly, and bright red breast patch. The female Rose-breasted Grosbeak is mottled brown above and streaked below with conspicuous white eye-stripes. Both sexes have large conical bills, dark legs, and squared-off tails. This species may be distinguished from the related Black-headed Grosbeak ( Pheucticus melanocephalus) by that species’ orange breast and from the similar-looking Eastern Towhee (Pipilo erythrophthalmus) by that species’ chestnut flanks, black breast, and rounded tail. The Rose-breasted Grosbeak breeds across the northeastern United States and southern Canada, north and west to British Columbia and south at higher elevations in the east to northern Georgia. In winter, this species migrates south to southern Mexico, Central America, and northern South America. On migration, this species may be found for short periods of time across the southeastern U.S. as far west as Texas. Rose-breasted Grosbeaks breed in a variety of woodland habitats, particularly in heavily-vegetated undergrowth near forest edges or clearings. In winter, this species may be found in similarly-structured habitats in tropical forests. Rose-breasted Grosbeaks eat a variety of plant and animal foods, including fruits, berries, and insects. In appropriate habitat, Rose-breasted Grosbeaks may be seen foraging for food in the branches of trees or shrubs and, less frequently, on the ground. This species also visits bird feeders when available, notably during migration, when individuals may frequent a particular backyard for a few days before moving on. Rose-breasted Grosbeaks are most active during the day, but, like many migratory songbirds, this species migrates at night.

Threat Status: Least Concern

  • Peterson, Roger Tory. Birds of Eastern and Central North America. Boston: Houghton Mifflin, 1980. Print.
  • Pheucticus ludovicianus. Xeno-canto. Xeno-canto Foundation, n.d. Web. 20 July 2012. .
  • Rose-breasted Grosbeak (Pheucticus ludovicianus). The Internet Bird Collection. Lynx Edicions, n.d. Web. 20 July 2012. .
  • Wyatt, Valerie E. and Charles M. Francis. 2002. Rose-breasted Grosbeak (Pheucticus ludovicianus), The Birds of North America Online (A. Poole, Ed.). Ithaca: Cornell Lab of Ornithology; Retrieved from the Birds of North America Online: http://bna.birds.cornell.edu/bna/species/692
  • eBird Range Map - Rose-breasted Grosbeak. eBird. Cornell Lab of Ornithology, N.d. Web. 20 July 2012. .
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Institution

Supplier: DC Birds

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Rose-breasted grosbeaks breed in northern North America, from British Columbia in the west to the Canadian maritime provinces in the east and as far south as New Jersey, the Appalachian Mountains through South Carolina, west to eastern Kansas, Nebraska, and the Dakotas. In winter they are found in the greater Antilles, coastal Mexico, and throughout Central America and northern South America to eastern Peru and Guyana. They are sometimes seen wintering in the lesser Antilles and Revillagigedo Islands as well. They are very occasionally seen in Europe.

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) BREEDS: northeastern British Columbia and southern Mackenzie to Nova Scotia, south to southern Alberta, northern North Dakota, eastern Nebraska, Oklahoma, southern Missouri, Indiana, northern Georgia, West Virginia, and North Carolina. NORTHERN WINTER: generally from central Mexico to northern South America (Colombia and northern Venezuela, more rarely to Ecuador, central Peru, southern Venezuela, Guyana [once]), occasionally north to U.S. Rare in West Indies.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Rose-breasted grosbeaks breed in northern North America, from British Columbia in the west to the Atlantic coast of Canada in the east and as far south as New Jersey, the Appalachian Mountains through South Carolina, west to eastern Kansas, Nebraska, and the Dakotas. In winter they are found in the greater Antilles, coastal Mexico, and throughout Central America and northern South America to eastern Peru and Guyana.

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

E Canada and US; > from Mexico to Peru and w Cuba.
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Rose-breasted grosbeaks are sexually dimorphic in plumage pattern. Males have vivid black and white feathers with a rose-colored throat, females have brown and white streaked plumage, with a distinct, buffy eyestripe. Rose-breasted grosbeaks are 18 to 21.5 cm long and from 39 to 49 grams. Males have a black head, white bill, are black and white dorsally and have a white belly and breast, topped with their rosy throat. Females are brown with white markings above and buffy with brown streaks on the belly, breast, and throat. Immature and non-breeding males take on some female plumage characteristics, such as the buffy white superciliary stripe and some brown and streaked plumage. There are no subspecies.

Rose-breasted grosbeak females are almost identical to females of the closely related black-headed grosbeaks (Pheucticus melanocephalus), although they tend to have more streaking on their breasts. Although the males of these two species differ in pattern, hybridization does occur where their ranges overlap in the central U.S. and southern Canada. The two species are ecologically similar and have similar songs.

Range mass: 39 to 49 g.

Range length: 18 to 21.5 mm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes colored or patterned differently; male more colorful

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Rose-breasted grosbeak males and females have different color patterns. Rose-breasted grosbeaks are 18 to 21.5 cm long and from 39 to 49 grams. Males have a black head, white bill, are black and white dorsally and have a white belly and breast, topped with their rosy throat. Females are brown with white markings above and buffy with brown streaks on the belly, breast, and throat.

Range mass: 39 to 49 g.

Range length: 18 to 21.5 mm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes colored or patterned differently; male more colorful

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 20 cm

Weight: 46 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

In their breeding range, rose-breasted grosbeaks are found in a wide variety of wooded habitats, including swamp or mesic forests, riparian corridors, and forest edges along marshes, roads, and pastures. They prefer mixed or deciduous woodlands with an open structure, such as second-growth habitats. They seem to avoid dry woodlands and grasslands. They are found in similar kinds of habitats along migratory routes and in their winter range. They are found at elevations up to 3800 m in Colombia.

Range elevation: 0 to 3800 m.

Habitat Regions: temperate ; tropical ; terrestrial

Terrestrial Biomes: forest ; scrub forest

Other Habitat Features: riparian

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Second-growth woods, mature forest edge, borders of swamps and wooded streams, dense growths of small trees, gardens and parks, old orchards. In migration and winter in various forest, woodland, and scrub habitats; avoids interior of closed forest. Usually remains high in trees but sometimes descends to ground (Stiles and Skutch 1989). Nests usually in thickets or small trees, generally 2-5 m above ground.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Rose-breasted grosbeaks are found in a wide variety of wooded habitats, including swamp or wet forests, forests along rivers and streams, and forest edges. They prefer mixed or deciduous woodlands with an open structure, such as second-growth habitats. They seem to avoid dry woodlands and grasslands.

Range elevation: 0 to 3800 m.

Habitat Regions: temperate ; tropical ; terrestrial

Terrestrial Biomes: forest ; scrub forest

Other Habitat Features: riparian

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Migrates through West Indies. Usually arrives in the eastern U.S. and southern Canada in May (Terres 1980). Arrives in Costa Rica mainly mid-October (occasionally by early September), departs usually by mid-April (or as late as early May) (Stiles and Skutch 1989). Arrives in Colombia as early as mid-October but mainly present from December onward; departs by late April (Hilty and Brown 1986).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Rose-breasted grosbeaks eat seeds, fruit, and insects, with proportions varying seasonally. During the breeding season they eat approximately 52% insects and 48% seeds and fruit. They may also eat the ovaries of flowers. During migration they rely heavily on fruits. There is less known about winter range diet, except that it includes fruits and oil-rich seeds. Rose-breasted grosbeaks forage throughout forest canopy levels and occasionally on the ground. They glean insects from leaves or can hover or hawk to capture insects. They often eat the fruiting body off of seeds or extract only the germ of seeds to eat. Insects eaten include beetles, including Colorado potato beetles (Leptinotarsa decimlineata), bees and ants, bugs, and butterfly larvae. They prey heavily on wild fruits such as elderberry (Sambucus canadensis), red-berried elder (Sambucus pubens), blackberry and raspberry (Rubus species), mulberry (Morus rubra), and juneberry (Amelanchier canadensis), and weed seeds, such as smartweed (Polygonum), pigweed (Amaranthus), foxtail (Setaria), milkweed (Asclepias), and sunflowers (Helianthus). They may also eat domestic crops, such as peas (Pisum sativum), corn (Zea mays), oats (Avena sativa), and wheat (Triticum vulgare).

Animal Foods: insects

Plant Foods: seeds, grains, and nuts; fruit; flowers

Primary Diet: omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Eats seeds, fruits, buds, and flowers of trees; and insects (caterpillars, lepidopterans, grasshoppers, etc.) (Terres 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Rose-breasted grosbeaks eat seeds, fruit, and insects, with proportions varying seasonally. During the breeding season they eat approximately 52% insects and 48% seeds and fruit. During migration they eat mostly fruits. Rose-breasted grosbeaks forage in tree branches or on the ground. They take insects from leaves or capture them in the air. Insects eaten include Coleoptera, including Leptinotarsa decimlineata, Hymenoptera, Hemiptera, and Lepidoptera. They prey heavily on wild berries, weed seeds, and will sometimes eat domestic crops like Pisum sativum, Zea mays, Avena sativa, and Triticum vulgare.

Animal Foods: insects

Plant Foods: seeds, grains, and nuts; fruit; flowers

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Rose-breasted grosbeak nests are parasitized by brown-headed cowbirds (Molothrus ater). However, aggressive nest defense by parents may make parasitism unlikely and the survival of grosbeak nestlings seems unaffected by parasitism. Other parasites are lice (Brueelia pallidula and Menacanthus eurysternus) and parasitic flies (Ornithoctona strigilecula and Ornithomya fringillina). Rose-breasted grosbeaks may help to disperse some seeds and control local insect populations.

Commensal/Parasitic Species:

  • brown-headed cowbirds (Molothrus ater)
  • lice (Brueelia pallidula)
  • lice (Menacanthus eurysternus)
  • parasitic flies (Ornithoctona strigilecula)
  • parasitic flies (Ornithomya fringillina)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Most predation is on eggs and nestlings. Rose-breasted grosbeak pairs will attack or mob perceived threats near their nests. Reported nest predators are blue jays (Cyanocitta cristata), common grackles (Quiscalus quiscula), grey squirrels (Sciurus carolinensis), and red squirrels (Tamiasciurus hudsonicus). Adults may be preyed on by Cooper's hawks (Accipiter cooperii) and sharp-shinned hawks (Accipiter striatus).

Known Predators:

  • blue jays (Cyanocitta cristata)
  • common grackles (Quiscalus quiscula)
  • grey squirrels (Sciurus carolinensis)
  • red squirrels (Tamiasciurus hudsonicus)
  • Cooper's hawks (Accipiter cooperii)
  • sharp-shinned hawks (Accipiter striatus)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecosystem Roles

Rose-breasted grosbeaks may help disperse fruit seeds and control insect populations in the ecosystems they live in. Their nests are parasitized by Molothrus ater, but parents usually keep cowbirds away. Other parasites are lice and parasitic flies.

Commensal/Parasitic Species:

  • brown-headed cowbirds (Molothrus_ater)
  • lice (Brueelia_pallidula)
  • lice (Menacanthus_eurysternus)
  • parasitic flies (Ornithoctona_strigilecula)
  • parasitic flies (Ornithomyia_anchineuria)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Most predation is on eggs and nestlings. Rose-breasted grosbeak pairs will attack predators near their nests. Reported nest predators are Cyanocitta cristata, Quiscalus quiscula, Sciurus carolinensis, and Tamiasciurus hudsonicus. Adults may be preyed on by Accipiter cooperii and Accipiter striatus.

Known Predators:

  • blue jays (Cyanocitta_cristata)
  • common grackles (Quiscalus_quiscula)
  • grey squirrels (Sciurus_carolinensis)
  • red squirrels (Tamiasciurus_hudsonicus)
  • Cooper's hawks (Accipiter_cooperii)
  • sharp-shinned hawks (Accipiter_striatus)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Pheucticus ludovicianus (Baltimore oriole, chickadee, least flycatcher, rosebreasted grosbeak, willow thrush) is prey of:
Accipiter striatus
Accipiter cooperii
Bubo virginianus

Based on studies in:
Canada: Manitoba (Forest)

This list may not be complete but is based on published studies.
  • R. D. Bird, Biotic communities of the Aspen Parkland of central Canada, Ecology, 11:356-442, from p. 406 (1930).
  • R. D. Bird, Biotic communities of the Aspen Parkland of central Canada, Ecology, 11:356-442, from p. 410 (1930).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Pheucticus ludovicianus (Baltimore oriole, chickadee, least flycatcher, rosebreasted grosbeak, willow thrush) preys on:
Araneae
Insecta

Based on studies in:
Canada: Manitoba (Forest)

This list may not be complete but is based on published studies.
  • R. D. Bird, Biotic communities of the Aspen Parkland of central Canada, Ecology, 11:356-442, from p. 406 (1930).
  • R. D. Bird, Biotic communities of the Aspen Parkland of central Canada, Ecology, 11:356-442, from p. 410 (1930).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

In winter, in flocks of 3-6, rarely up to 20 (Stiles and Skutch 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Rose-breasted grosbeaks are known for their lovely, melodic song. Males sing to advertise breeding territories, up to 689 songs in a day. Females may also sing when they are building nests. Other calls used include a sharp "chink" contact call and various squawks, chuks, and hurrrs used in different contexts. Young first make sounds at 6 days after hatching and young males produce their first songs at about 30 days old. Songs seems to be learned.

Communication Channels: acoustic

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Communication and Perception

Rose-breasted grosbeaks are known for their lovely, melodic song. Males sing to advertise breeding territories, up to 689 songs in a day. Females may also sing when they are building nests. Other calls used include a sharp "chink" contact call and various squawks, chuks, and hurrrs. Young first make sounds at 6 days after hatching and young males sing their first songs at about 30 days old. Songs seems to be learned.

Communication Channels: acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

The oldest reported wild bird was banded at almost 13 years old. Captive birds have lived up to 24 years. Estimates of annual survival are 48% in young birds and 61% in adults.

Range lifespan

Status: wild:
13 (high) years.

Range lifespan

Status: captivity:
24 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan/Longevity

The oldest reported wild bird was captured at almost 13 years old. Captive birds have lived up to 24 years.

Range lifespan

Status: wild:
13 (high) years.

Range lifespan

Status: captivity:
24 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 24 years
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Rose-breasted grosbeaks are monogamous, but no research has been done on extra-pair copulations. Pair bonds are formed in spring on the breeding grounds, when females approach territorial, singing males. Males may first reach aggressively towards females. Males use several kinds of courtship displays with females: the rapid warble flight and wing-fluff, both of which are accompanied by a warbling song. Warble flight involves the male flying slowly with his tail spread and with small movements of the wings, the wing-fluff involves the male holding his wings out to the side with his tail spread and moving his head and body from side to side as he hops on a branch.

Mating System: monogamous

Rose-breasted grosbeaks begin building nests in May and lay from 1 to 5 (usually 4) pale, bluish-green eggs speckled with darker colors. Nests are constructed in trees, shrubs, or vines from 0.8 to 16.8 m high. Nest are constructed of loosely woven grass and twigs formed into cup-shapes. Finer materials line the nest, such as shredded bark, pine needles, and fine grasses. Generally 1 brood is laid each year, although second broods are sometimes attempted. Females lay eggs about once per day until the clutch size is reached and begin incubating at the next to last egg laid. Eggs hatch asynchronously from 11 to 14 days after the beginning of incubation and young fledge after 9 to 12 days. The young are dependent on their parents for another 3 weeks after fledging and remain with the parents throughout the summer until migration. Young are able to breed in their first year after hatching.

Breeding interval: Rose-breasted grosbeaks breed once yearly, rarely attempting second broods.

Breeding season: Breeding occurs from mid-May through July throughout the range.

Range eggs per season: 1 to 5.

Average eggs per season: 4.

Range time to hatching: 11 to 14 days.

Range fledging age: 9 to 12 days.

Average fledging age: 10 days.

Average time to independence: 3 weeks.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Both females and males incubate the eggs and brood the young. Young are altricial at hatching, with light down and weighing about 4.5 g. Males and females both provide food for the young throughout their nestling period. They provide up to 75% crushed insects to the young.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female); post-independence association with parents

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eggs are laid mostly in May-June. Clutch size is 3-5. Incubation lasts 12-14 days, by both sexes. Young are tended by both parents, leave nest at 9-12 days, dependent on adults for about 3 weeks more. Male may feed fledglings while female renests.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Rose-breasted grosbeaks form mated pairs during breeding season. Pair bonds form in spring on the breeding grounds, when females approach territorial, singing males. Males use several kinds of courtship displays with females: the rapid warble flight and wing-fluff, both of which are accompanied by a warbling song. Warble flight involves the male flying slowly with his tail spread and with small movements of the wings, the wing-fluff involves the male holding his wings out to the side with his tail spread and moving his head and body from side to side as he hops on a branch.

Mating System: monogamous

Rose-breasted grosbeaks begin building nests in May and lay from 1 to 5 (usually 4) pale, bluish-green eggs speckled with darker colors. Nests are constructed in trees, shrubs, or vines and are made of loosely woven grass and twigs formed into cup-shapes. Generally 1 set of young is laid each year. Eggs hatch from 11 to 14 days after the beginning of incubation and young can fly after 9 to 12 days. The young are dependent on their parents for another 3 weeks after fledging and remain with the parents throughout the summer until migration. Young are able to breed in their first year after hatching.

Breeding interval: Rose-breasted grosbeaks breed once yearly, rarely attempting second broods.

Breeding season: Breeding occurs from mid-May through July throughout the range.

Range eggs per season: 1 to 5.

Average eggs per season: 4.

Range time to hatching: 11 to 14 days.

Average birth mass: 4.5 g.

Range fledging age: 9 to 12 days.

Average fledging age: 10 days.

Average time to independence: 3 weeks.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Both females and males incubate the eggs, keep the young warm once hatched, and feed the young. Young are naked and helpless at hatching, with light down and weighing about 4.5 g. Parents feed nestlings up to 75% crushed insects. Young still depend on their parents for 3 weeks after they can fly and remain with them through their first summer.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female); post-independence association with parents

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pheucticus ludovicianus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACATTCATTACTCGATGATTATTCTCAACCAACCACAAAGATATCGGGACACTGTACCTAATCTTCGGCGCATGAGCCGGAATAGTAGGTACTGCCCTAAGCCTCCTTATCCGAGCAGAATTAGGACAACCTGGAGCCCTCCTAGGAGACGACCAAGTTTACAACGTAGTCGTCACAGCCCATGCTTTCGTAATAATTTTCTTCATAGTTATACCAATTATAATCGGAGGGTTTGGAAACTGACTAGTCCCCCTAATAATTGGAGCCCCAGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTTCTACCCCCATCCTTCCTACTCCTCCTAGCATCCTCTACAGTCGAAGCAGGTGCAGGTACAGGATGAACGGTATATCCACCATTAGCTGGTAACCTAGCCCATGCCGGAGCTTCAGTTGACCTAGCAATCTTCTCCCTACATCTAGCTGGTATCTCCTCAATCCTGGGAGCTATCAACTTCATCACAACAGCAATCAACATAAAACCCCCTGCCCTTTCACAATACCAAACCCCCCTATTCGTATGATCCGTATTAATCACCGCAGTACTACTTCTCCTCTCCCTTCCAGTGCTTGCCGCAGGCATTACAATGCTCCTTACAGACCGTAACCTCAATACTACATTCTTCGACCCTGCTGGAGGAGGAGACCCTGTGCTATACCAACACCTTTTCTGATTCTTCGGCCACCCAGAAGTCTACATCCTAATCCTACCAGGATTCGGAATCATCTCTCACGTCGTAACATACTACGCAGGCAAAAAAGAACCATTCGGCTACATGGGGATAGTATGAGCCATGCTATCCATCGGGTTCCTAGGCTTCATCGTCTGAGCCCACCACATGTTTACAGTAGGAATAGACGTTG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Pheucticus ludovicianus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5