Articles on this page are available in 1 other language: Spanish (4) (learn more)

Overview

Distribution

Pheucticus melanocephalus is found throughout most of western North America, from the Pacific to the eastern foothills of the Rocky Mountains. These birds winter in Mexico and spend the remainder of the year throughout western United States and Canada, from Montana through Oregon and along the Pacific coast to Baja, California. Black-headed grosbeaks are found as far east as Kansas and Oklahoma and north throughout the provinces of Saskatchewan and British Columbia.

Biogeographic Regions: nearctic (Native ); neotropical (Native )

  • 1997. "Chipper Woods Bird Observatory" (On-line). Wild Birds Unlimited. Accessed October 15, 2005 at http://www.wbu.com/chipperwoods/photos/rbgrosbeak.htm.
  • Copyright © 2005 NatureServe, 1101 Wilson Boulevard, 15th Floor, Arlington Virginia 22209, U.S.A. All Rights Reserved. 2005. "NatureServe Explorer: An online encyclopedia of life" (On-line). NatureServe. Accessed November 21, 2005 at http://www.natureserve.org/explorer.
  • Lynes, M. 1998. "Black-headed Grosbeak (Pheucticus melanocephalus). In The Riparian Bird Conservation Plan: a strategy for reversing the decline of riparian-associated birds in California" (On-line). California Partners in Flight. Accessed October 16, 2005 at http://www.prbo.org/calpif/htmldocs/riparian_v-2.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: BREEDS: southwestern British Columbia, east to southwestern Saskatchewan, northeastern Montana, northwestern North Dakota, south along Pacific coast to northern Baja California, central and southeastern Arizona, eastern New Mexico and south into mainland of Mexico; east to central Nebraska, central Kansas, western Oklahoma, western Texas. WINTERS: in Mexico (Terres 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Black-headed grosbeaks have the distinctive grosbeak bill, which is large, conical, thick, and straw-colored. Both genders have yellow wing linings. Females differ in color from males, featuring brown to dark grey feathers with a striped head, back, and sides, a paler bill, white wing bar, and a tan breast. Their more colorful male counterparts have white patches on the wings, a black and white tail, and black head with bright orangish-brown underparts and red legs. They are from 15 to 20 cm in length, with wingspans from 30 to 33 cm, and weighing from 38 to 54 grams.

Range mass: 38 to 54 g.

Range length: 15 to 20 cm.

Range wingspan: 30 to 33 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes colored or patterned differently; male more colorful

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 21 cm

Weight: 47 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Black-headed grosbeaks prefer deciduous and broad-leaved evergreen woods, nesting in thickets on the edges of open woods, ponds, swamps, or streams, or in small trees.

Range elevation: 1,524 to 2,743 m.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: forest

Wetlands: swamp

Other Habitat Features: riparian

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Deciduous forest and woodland, pine-oak association, oak scrub, pinyon-juniper woodland and deciduous thickets (Subtropical and Temperate zones) (AOU 1983). Often found on edges of ponds, streams, or forests. Usually nests in open woodlands or in trees and shrubs near streams and swamps, usually 1-8 m above ground.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Breeding populations in U.S. are long-distance migrants, move south for winter. Males arrive in north in spring about a week before females arrive.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Black-headed grosbeaks prey mainly on insects and other invertebrates during the breeding season, including spiders, beetles, scale insects, flies, wasps, bees, grasshoppers, codling moth caterpillars, and cankerworms. They also eat small fruits, such as cherries, blackberries, raspberries, strawberries, elderberries, and mistletoe berries; as well as buds and seeds, which they can crack open with their large and sturdy bill. Black-headed grosbeaks forage in trees and shrubs, predominantly obtaining food from gleaning. They come readily to feeding stations and campgrounds. Their winter diet is mostly unknown.

Animal Foods: insects; terrestrial non-insect arthropods

Plant Foods: seeds, grains, and nuts; fruit

Primary Diet: omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Feeds on insects, spiders, berries, seeds, and buds. Forages in the crowns of deciduous trees; also forages in shrubs and on the ground.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Black-headed grosbeak eggs provide food for a multitude of predators, including all those mentioned in predation, above. They are also predators of insects and other terrestrial invertebrates, impacting their populations, and act to disperse seeds of the fruit they eat. Brown-headed cowbirds (Molothrus ater) infrequently form a parasitic relationship with grosbeaks in Kansas, Nebraska, Colorado, Utah, and Montana. A nest parasite, cowbirds lay eggs in black-headed grosbeak nests, which are then raised by the grosbeak "parents".

Ecosystem Impact: disperses seeds

Commensal/Parasitic Species:

  • Brown-headed cowbird (Molothrus ater)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Though little is known about predators of adult black-headed grosbeaks, although domestic and feral cats (Felis silvestris) have been known to eat adult birds. Eggs and nestlings are taken by a variety of predators, ranging from other birds, such as western scrub-jays (Aphelocoma californica) and magpies (Pica), to snakes, rock squirrels (Spermophilus variegatus), deer mice (Peromyscus), chipmunks, striped skunks (Mephitis mephitis), raccoons (Procyon lotor), and weasels (Mustela). This is countered by aggressive nest defense by parent birds, who attack egg predators with their sharp, large beaks.

Known Predators:

  • magpies (Pica)
  • western scrub-jay (Aphelocoma californica)
  • rock squirrels (Spermophilus variegatus)
  • chipmunks (Tamias)
  • deer mice (Peromyscus)
  • garter snakes (Thamnophis)
  • raccoons (Procyon lotor)
  • striped skunks (Mephitis mephitis)
  • weasels (Mustela)
  • domestic cats (Felis silvestris)

  • Ortega, C., J. Ortega. 2002. Comparison of Black-Headed Grosbeaks Nesting in Riparian and Gambel Oak Pastures in Southwestern Colorado. Southwestern Naturalist, Volume 48, Issue 3: 383--388.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Both the male and female defend their nesting territory against other breeding pairs. Jays are primary nest predators in New Mexico (Hill 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Black-headed grosbeaks have a distinct song which resembles its close relative, rose-breasted grosbeaks (Pheucticus ludovicianus). This song is similar to that of a robin or western tanager, but richer and clearer, containing whistled notes, trills, and a back-and-forth warble. Males sing to declare territory and attract females, while females use song while foraging, to communicate or respond to other females, and to maintain contact with their offspring. Black-headed grosbeaks also use visual cues in communication, such as in assessing mates and responding to young.

Communication Channels: visual ; acoustic

Other Communication Modes: choruses

Perception Channels: visual ; polarized light ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

In the wild, black-headed grosbeaks have an expected lifespan between 5 and 6 years. In captivity, however, they have lived as long as 25 years.

Range lifespan

Status: captivity:
25 (high) years.

Average lifespan

Status: wild:
143 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 25 years (captivity) Observations: Maximum longevity from banding studies was 11.9 years (Blumstein and Moller 2008). One specimen lived 25 years in captivity (http://bna.birds.cornell.edu/).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Black-headed grosbeaks are monogamous. Males arrive in the spring about six days before the females, remaining solitary until the females arrive. Males sing to establish territory and attract mates. Older males get higher quality territories, and fighting for territory can be aggressive, as black-headed grosbeaks attack swiftly during flight. Once females arrive, males will sing from perches near females, occasionally flying up into the air while singing a courtship song.

Mating System: monogamous

Black-headed grosbeak females build a nest between 4 and 25 feet above the ground over a period of 3 to 4 days, usually in deciduous trees; especially willows and coast live oaks. The nest could also be located in shrubs, bordering streams, or more rarely, gardens and parks. The nest itself is constructed thinly and loosely with twigs, rootlets, and other plant materials and placed in the dense outer foliage of a tree or shrub near an opening.

Black-headed grosbeaks produce one brood per year in the spring and early summer, from April to July. They lay 2 to 5 eggs per season. The eggs vary in color from greenish or bluish to spotted brown. Eggs hatch in 12 to 13 days with all eggs hatching within a 24 hour period. Young fledge after about 12 days, becoming independent after another 14 days. Females reach reproductive maturity around 1 year, while males mature after 3 years.

Breeding interval: Black-headed grosbeaks produce one brood every year.

Breeding season: Copulation and nesting for Pheucticus melanocephalus occurs from April through July.

Range eggs per season: 2 to 5.

Average eggs per season: 3-4.

Range time to hatching: 12 to 13 days.

Range fledging age: 11 to 15 days.

Range time to independence: 23 to 30 days.

Range age at sexual or reproductive maturity (female): 1 to 1 years.

Range age at sexual or reproductive maturity (male): 2 to 4 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Average eggs per season: 3.

Both sexes invest time incubating the eggs, alternating sitting periods throughout the 12 to 13 days of incubation. Occasionally, both parents will sit on the nest and sing simultaneously. In a similar fashion, both parents feed their nestlings, and females occasionally use song to communicate with their young. Males depart for breeding grounds earlier, leaving females to feed their fledged young.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female)

  • Ehrlich, P., D. Dobkin, D. Wheye. 1988. The Birders Handbook: A Field Guide to the Natural History of North American Birds. New York: Simon and Schuster Inc..
  • Kroodsma, R. 1974. Species-Recognition behavior of territorial rose-breasted and black-headed grosbeaks. The Auk, Volume 91: 54-64. Accessed November 21, 2005 at http://elibrary.unm.edu/sora/Auk/v09/n01/p0054-p0064.pdf.
  • Lynes, M. 1998. "Black-headed Grosbeak (Pheucticus melanocephalus). In The Riparian Bird Conservation Plan: a strategy for reversing the decline of riparian-associated birds in California" (On-line). California Partners in Flight. Accessed October 16, 2005 at http://www.prbo.org/calpif/htmldocs/riparian_v-2.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Clutch size typically is 3-4. Incubation, by both parents, lasts 12-13 days. Altricial young are tended by both parents, leave nest in 9-12 days. See Hill (1988) for information on reproduction in New Mexico.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pheucticus melanocephalus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 10 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACTGTACTTAATCTTCGGCGCATGAGCCGGAATAGTAGGTACTGCCCTAAGCCTCCTTATCCGAGCAGAATTAGGACAACCTGGAGCCCTTCTAGGAGACGACCAAGTTTACAACGTAGTCGTCACAGCCCATGCTTTCGTAATAATTTTCTTCATAGTTATGCCAATTATAATCGGAGGGTTTGGAAACTGATTAGTCCCTCTAATAATTGGAGCCCCAGACATAGCATTCCCACGAATAAATAACATAAGCTTTTGACTTCTACCCCCATCCTTCCTACTCCTCCTGGCATCCTCTACAGTCGAAGCAGGCGCAGGCACAGGATGAACAGTATATCCACCACTAGCTGGTAACTTAGCCCATGCCGGAGCTTCAGTTGACCTAGCAATCTTCTCCCTACATCTAGCCGGTATCTCTTCAATCCTAGGGGCCATCAACTTCATCACAACAGCAATCAACATAAAACCCCCTGCCCTTTCACAATACCAAACCCCATTATTCGTATGATCCGTACTAATCACTGCAGTACTACTTCTCCTCTCCCTTCCGGTGCTTGCCGCAGGCATCACAATGCTTCTTACAGACCGTAACCTAAACACCACATTCTTCGACCCTGCTGGAGGAGGAGACCCTGTACTATACCAACACCTTTTCTGATTCTTTGGCCATCCAGAAGTCTACATCCTAATCCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Pheucticus melanocephalus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 12
Specimens with Barcodes: 18
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5