Articles on this page are available in 1 other language: Spanish (7) (learn more)

Overview

Brief Summary

Passerina cyanea

A small (5 ½ inches) bunting, the male Indigo Bunting is most easily identified by its bright blue body, dark wings and tail, and small conical bill. The female Indigo Bunting is brownish gray on top and pale brown below. Male Indigo Buntings resemble females during their autumn molt, taking on brown feathers in place of the bright blue plumage they wore during the breeding season. The Indigo Bunting breeds across much of the eastern United States and southern Canada south to central Florida and Texas. This species also breeds locally west of the plains as far as California and the southwest. In winter, Indigo Buntings may be found in south Florida, southern Mexico, Central America, and the West Indies. Indigo Buntings breed in forest edges and clearings of open deciduous woodlands. During the winter, this species may be found in tropical grassland and scrubland. Indigo Buntings primarily eat insects during the summer, adding seeds and berries to their diet in the winter. In appropriate habitat, Indigo Buntings may be seen foraging for food in shrubs and low tree branches. Birdwatchers may also listen for this species’ song, a series of paired notes vaguely recalling that of a finch. Indigo Buntings are primarily active during the day.

Threat Status: Least Concern

  • Indigo Bunting (Passerina cyanea). The Internet Bird Collection. Lynx Edicions, n.d. Web. 20 July 2012. .
  • Passerina cyanea. Xeno-canto. Xeno-canto Foundation, n.d. Web. 20 July 2012. .
  • Payne, Robert B. 2006. Indigo Bunting (Passerina cyanea), The Birds of North America Online (A. Poole, Ed.). Ithaca: Cornell Lab of Ornithology; Retrieved from the Birds of North America Online: http://bna.birds.cornell.edu/bna/species/004
  • Peterson, Roger Tory. Birds of Eastern and Central North America. Boston: Houghton Mifflin, 1980. Print.
  • eBird Range Map - Indigo Bunting. eBird. Cornell Lab of Ornithology, N.d. Web. 20 July 2012. .
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Institution

Supplier: DC Birds

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Indigo buntings (Passerina cyanea) breed throughout eastern North America from the Great Plains eastward, south of the coniferous forest region. There are also some breeding populations in the western United States, including Utah, Arizona and California. Indigo buntings winter in the coastal regions of Mexico, Central America, northern South America and the Caribbean.

Biogeographic Regions: nearctic (Native ); neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: BREEDING: southeastern British Columbia and southeastern Saskatchewan across southern Canada to southern Maine, southern New Brunswick, and Nova Scotia, south to southern New Mexico, southern Texas, Gulf Coast, and central Florida; sporadic breeding southwest to southern California, southeastern Arizona, and southwestern Utah (Payne 1992, AOU 1998). NON-BREEDING: Nayarit, San Luis Potosi, and Bermuda south to Panama and northwestern Colombia; Bahamas, Greater Antilles (including the Virgin Islands), Cayman Islands; rarely from southern Texas, Gulf Coast, and Florida south (AOU 1998).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Indigo buntings (Passerina_cyanea) breed throughout eastern North America from the Great Plains eastward, south of the coniferous forest region. There are also some breeding populations in the western United States, including Utah, Arizona and California. Indigo buntings winter in the coastal regions of Mexico, Central America, northern South America and the Caribbean.

Biogeographic Regions: nearctic (Native ); neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Canada and US; > to Gr. Antilles, Colombia and Venezuela.
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Adult male indigo buntings are brilliant blue during the breeding season, with a darker almost purple crown. Females and young are brown with buff wingbars and only a tinge of blue on their tail and shoulders. Indigo buntings are small birds, from 11.5 cm to13 cm long and weighing 12 to 18 g. They have short, conical beaks and black or gray legs and feet. (Payne 1992, Robbins, Bruun and Zim 1983)

Range mass: 12 to 18 g.

Range length: 11.5 to 13 cm.

Sexual Dimorphism: sexes colored or patterned differently; male more colorful

Other Physical Features: endothermic ; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Adult male indigo buntings are brilliant blue during the breeding season, with a darker almost purple crown. Females and young are brown with buff wingbars. They have only a tinge of blue on their tail and shoulders. Indigo buntings are small birds, from 11.5 cm to13 cm long. They weigh 12 to 18 g. They have short, conical beaks and their legs and feet are black or gray. (Payne 1992, Robbins, Bruun and Zim 1983)

Range mass: 12 to 18 g.

Range length: 11.5 to 13 cm.

Sexual Dimorphism: sexes colored or patterned differently; male more colorful

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 14 cm

Weight: 15 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

See Kaufman (1989) for information on identification.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indigo buntings breed in brushy and weedy habitats along the edges of farmed land, woods, road, power lines, railways and riparian habitats. They also breed in clearings in open deciduous woodlands, in weedy or abandoned agricultural fields, and in swamps. During migration they look for open grasslands and leafy trees similar to those in their winter habitat. In winter, indigo buntings choose open habitats, such as weedy fields, citrus orchards, savannas, weedy croplands and low second growth (Payne 1992).

Habitat Regions: temperate ; tropical

Terrestrial Biomes: savanna or grassland ; forest

Wetlands: swamp

Other Habitat Features: agricultural ; riparian

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: BREEDING: Deciduous forest edge and clearings, open woodland, second growth, shrubby areas, scrub, cultivated lands, weedy fields, orchards, hedgerows, overgrown fencerows; avoids mature forests. Nests in crotch of saplings, small bushes, weeds, thickets, vine patch, canebrakes, sometimes in trees, to about four meters above ground in dense cover. Most settle and breed more than two kilometers from their natal site; locally hatched birds comprised 1.6% and 13% of the breeding population in areas of 10 and 4 sq km (Payne 1991). Commonly returns to territory used in previous year (Payne and Payne 1993). NON-BREEDING: In migration, open grasslands, bushes, and leafy trees (Payne 1992). In winter, weedy fields, cropland, and orchards; savanna; and low second growth (Payne 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indigo buntings breed in brushy and weedy areas at the edge of openings. For example, the like the brush along the edges of farm fields, or along rivers, roads or railroad tracks. They also like to breed in weedy open areas, such as old farm fields, or in swamps. In the winter, indigo buntings choose open habitats, such as weedy fields, citrus orchards, savannas, and young forests (Payne 1992).

Habitat Regions: temperate ; tropical

Terrestrial Biomes: savanna or grassland ; forest

Wetlands: swamp

Other Habitat Features: agricultural ; riparian

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Males generally appear in nesting range in May (Terres 1980). Arrives in Costa Rica early to mid-October, departs by late April (Stiles and Skutch 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

During the breeding season, indigo buntings eat small spiders and insects, seeds of grasses and herbs, and berries. Major food items taken include caterpillars, grasshoppers, bugs, beetles, seeds and berries. In winter, indigo buntings eat small seeds, buds, and some insects. Their main food in winter is small seeds of grasses. They also frequent feeders, and eat the seeds of rice in rice fields. Indigo buntings do not appear to drink frequently, and may obtain sufficient water from their diet. (Payne 1992)

Indigo buntings feed alone during the breeding season and in flocks during the winter. They do not appear to store food for later consumption. (Payne 1992)

Animal Foods: insects; terrestrial non-insect arthropods

Plant Foods: seeds, grains, and nuts; fruit

Primary Diet: omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Eats insects, weed seeds, small grains, small fruits; forages in trees, shrubbery, on ground (Terres 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

During the breeding season, indigo buntings eat small spiders and insects, seeds and berries. Common food items include caterpillars, grasshoppers, bugs, beetles, seeds and berries. In winter, indigo buntings eat small seeds, buds, and some insects. Their main food in winter is small seeds of grasses. They also commonly rice in fields where it is grown. Indigo buntings do not seem to drink very often. They probably get enough water from their food. (Payne 1992)

Indigo buntings feed alone during the breeding season. In winter, they feed in flocks. They do not store food to eat later.

Animal Foods: insects; terrestrial non-insect arthropods

Plant Foods: seeds, grains, and nuts; fruit

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Perching birds (order Passeriformes) as a group play an important role in the earth's ecosystems. They consume many varieties and amounts of food and serve as food for others and hosts for parasites (Britannica, 1986). Indigo buntings affect the populations of the insects they eat, and help distribute seeds of the plants whose berries they eat. They also host at least one parasite; hippoboscid flies (Payne 1992).

Ecosystem Impact: disperses seeds

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Although predation of adult indigo buntings surely occurs, specific predators have not been identified. Brooding females, eggs and young are vulnerable to predation from climbing predators, including raccoons, opossum, red fox, feral cats, blue jays and blue racers.

When a predator approaches a nest, adult buntings may feign injury and make a chip-chip-chip call to distract the predator and lure them away from the nest. They do not mob predators.

Known Predators:

  • Virginia opossums (Didelphis virginiana)
  • red foxes (Vulpes vulpes)
  • feral cats (Felis silvestris)
  • blue jays (Cyanocitta cristata)
  • blue racers (Coluber constrictor)
  • raccoons (Procyon lotor)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecosystem Roles

Indigo buntings affect the populations of the insects they eat. They also help distribute seeds of the plants whose berries they eat. They host at least one parasite, called hippoboscid flies (Payne 1992).

Ecosystem Impact: disperses seeds

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Incubating females, eggs and young are eaten by climbing predators. These predators include Procyon lotor, Didelphis virginianus, Vulpes vulpes, feral cats, Cyanocitta cristata and Constrictor colubris. Though adults are surely eaten too, we do not know who the predators of adults are.

Adult buntings may pretend to be injured to distract predators from their nest.

Known Predators:

  • Virginia opossums (Didelphis_virginiana)
  • red foxes (Vulpes_vulpes)
  • feral cats (Felis_silvestris)
  • blue jays (Cyanocitta_cristata)
  • blue racers (Coluber_constrictor)
  • raccoons (Procyon_lotor)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Passerina cyanea (indigo bunting) preys on:
Diptera
Coleoptera

Based on studies in:
USA: Illinois (Forest)

This list may not be complete but is based on published studies.
  • A. C. Twomey, The bird population of an elm-maple forest with special reference to aspection, territorialism, and coactions, Ecol. Monogr. 15(2):175-205, from p. 202 (1945).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Passerina cyanea (indigo bunting) is prey of:
Felidae
Strix varia

Based on studies in:
USA: Illinois (Forest)

This list may not be complete but is based on published studies.
  • A. C. Twomey, The bird population of an elm-maple forest with special reference to aspection, territorialism, and coactions, Ecol. Monogr. 15(2):175-205, from p. 202 (1945).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

In Costa Rica and Mexico, sometimes alone or in small groups, more often in flocks of 20 or more that move to areas with seeding grasses (Stiles and Skutch 1989, Rappole and Warner 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Indigo buntings use vocalizations and visual cues to communicate. Only male indigo buntings sing. Each male has one complex song that it sings, during the breeding season to advertise occupancy of a territory to other males and to attract females. Males may also court females by performing displays, such as the display in which a male struts in circles in front of a female with his wings spread and his head crouched.

Communication Channels: visual ; acoustic

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Communication and Perception

Indigo buntings use songs, calls and physical displays to communicate. Only male indigo buntings sing. Each male has one complex song that it sings during the breeding season. Males sing to defend their territory from other males and to attract females. Males may also try to attract a female by performing displays. For example, males may strut in circles in front of a female, spreading his wings and crouching his head. This display is part of courtship.

Communication Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Indigo buntings can live up to 10 years in the wild.

Range lifespan

Status: wild:
10 (high) years.

Average lifespan

Status: wild:
111 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan/Longevity

Indigo buntings can live up to 10 years in the wild.

Range lifespan

Status: wild:
10 (high) years.

Average lifespan

Status: wild:
111 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 11 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Indigo buntings are socially monogamous. However, pairs only associate until incubation begins, and may switch partners within a single breeding season. Fertilizations outside of a breeding pair are not uncommon and approximately 15% of males have more than one mate.

Males do not sing often in courtship, but they do follow their mate around during the nest building and laying periods, often chasing other males away.

Mating System: monogamous

Indigo buntings breed between May and September, with most activity occurring June through August. They may raise more than one brood per season, and may switch nests or mates between broods. The female chooses the nest site and builds the nest, which may take up to eight days. Nests are built in shrubs in fields or at the edges of woods, roadsides and railways. They are constructed of leaves, grasses, stems and strips of bark. After the nest is complete, the female lays 1 to 4 (usually 3 or 4) white eggs. One egg is laid each day, soon after sunrise. The female begins incubating after the last egg is laid. Incubation lasts for 11 to 14 (usually 12 to 13) days.

The female broods the altricial chicks for the first few days after they hatch. She also feeds the chicks insects and removes their fecal sacs from the nest. The chicks leave the nest 8 to 14 days after hatching, and become independent about 3 weeks after fledging. Indigo buntings are sexually mature at one year old.

Breeding interval: Indigo buntings breed between May and September, with most activity occurring June through August.

Breeding season: Indigo buntings may raise more than one brood per season, and may switch nests or mates between broods.

Range eggs per season: 1 to 4.

Average eggs per season: 3.5.

Range time to hatching: 11 to 14 days.

Average time to hatching: 12-13 days.

Range fledging age: 8 to 14 days.

Average time to independence: 3 weeks.

Range age at sexual or reproductive maturity (female): 1 (low) years.

Range age at sexual or reproductive maturity (male): 1 (low) years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Average eggs per season: 4.

The male does not generally help with incubation or raising the chicks. The female chooses the nest site and builds the nest. She broods the altricial chicks for the first few days after they hatch, feeds them insects and removes their fecal sacs from the nest. The chicks leave the nest 8 to 14 days after hatching, and become independent about 3 weeks after fledging.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Clutch size is three-six (commonly three-four). Sometimes produces two broods per year. Incubation lasts 12-13 days, by female. Young leave nest at 9-13 days; male may or may not feed nestlings and/or fledged young. Males sometimes have more than one female nesting on their territories.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indigo buntings are monogamous. This means that one male usually mates with one female. However, about 15% of males have more than one mate. Also, pairs do not stay together for very long. After the eggs are laid, the male leaves the female and she raises the chicks alone. Pairs may split and chose other mates during a breeding season. Indigo buntings sometimes mate with an individual that is not their partner.

Males do not sing often in courtship, but they do follow their mate around during the nest building and laying periods. They may chase other males away.

Mating System: monogamous

Indigo buntings breed between May and September. They may raise more than one brood during the breeding season. They may also change mates or move to a new location when they begin a second brood. The female indigo bunting chooses the nest site and builds the nest by herself. Building the nest may take her up to eight days. Nests are built in tall shrubs in fields or at the edges of woods, roadsides and railways. They are made of leaves, grasses, stems and strips of bark. After the nest is finished, the female lays 1 to 4 (usually 3 or 4) white eggs. One egg is laid each day, early in the morning. The female incubates the eggs for 11 to 14 (usually 12 to 13) days.

The chicks are helpless (altricial) when they hatch. The female must brood them for the first few days to keep them warm on cool days and protect them from the heat on hot, sunny days. She feeds the chicks insects and removes their fecal sacs from the nest. The chicks leave the nest 8 to 14 days after they hatch. They become independent about 3 weeks after they leave the nest. They may begin breeding the next summer.

Breeding interval: Indigo buntings breed between May and September, with most activity occurring June through August.

Breeding season: Indigo buntings may raise more than one brood per season, and may switch nests or mates between broods.

Range eggs per season: 1 to 4.

Average eggs per season: 3.5.

Range time to hatching: 11 to 14 days.

Average time to hatching: 12-13 days.

Range fledging age: 8 to 14 days.

Average time to independence: 3 weeks.

Range age at sexual or reproductive maturity (female): 1 (low) years.

Range age at sexual or reproductive maturity (male): 1 (low) years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Average eggs per season: 4.

The female chooses the nest site and builds the nest. She broods the chicks for the first few days after they hatch. She also feeds them insects and cleans the nest. The chicks leave the nest 8 to 14 days after they hatch. They become independent about 3 weeks after they first leave the nest. The male parent does not help incubate or raise the chicks.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Passerina cyanea

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNNCTGTACCTAATCTTCGGTGCATGAGCCGGGATAGTAGGTACTGCCCTAAGCCTCCTCATCCGAGCAGAACTAGGCCAACCTGGAGCTCTTCTAGGAGACGACCAAGTCTACAACGTGGTCGTCACAGCCCATGCTTTTGTAATAATTTTCTTCATAGTTATACCAATTATAATCGGAGGGTTCGGAAACTGACTAGTCCCCTTAATAATCGGAGCCCCAGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTACTCCCCCCATCCTTCCTACTTCTCCTAGCGTCCTCCACAGTCGAAGCAGGGGTAGGCACAGGATGAACAGTCTACCCCCCACTAGCTGGCAACTTAGCCCACGCCGGAGCCTCAGTTGACCTGGCAATCTTCTCCCTACACCTAGCCGGTATCTCTTCCATTCTAGGAGCCATCAACTTTATTACAACAGCAATTAACATAAAACCCCCTGCCCTTTCACAATACCAAACCCCCTTATTCGTCTGATCAGTCCTAATTACCGCAGTTCTCTTACTCCTATCCCTACCAGTACTAGCCGCAGGGATCACTATACTTCTAACAGACCGTAACCTCAATACCACATTCTTTGATCCCGCTGGAGGAGGAGACCCAGTTCTATACCAGCATCTCTTCTGATTTTTCGGTCACCCAGAAGTCTACATTCTAATCCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Passerina cyanea

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 13
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5