Articles on this page are available in 1 other language: Spanish (7) (learn more)

Overview

Brief Summary

The Blue-grey Tanager (Thraupis episcopus) is a medium-sized South American songbird of the Tanager family, Thraupidae. Its range is from Mexico south to northeast Bolivia and northern Brazil, all of the Amazon Basin, except the very south. It has been introduced to Lima (Peru). On Trinidad and Tobago, this bird is called Blue Jean. The Blue-grey Tanager is 16–18 cm (6.3-7.1 in) long and weighs 30-40 grams (1.1-1.4 oz.) Adults have a light bluish head and underparts, with darker blue upperparts and a shoulder patch colored a different hue of blue. The bill is short and quite thick. Sexes are similar, but the immature is much duller in plumage. The song is a squeaky twittering, interspersed with tseee and tsuup call notes. Read more...
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

© Wikipedia Editors and contributors

Supplier: Tracy Barbaro

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 9.5 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Thraupis episcopus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AAAGACATTGGCACCCTGTACCTAATCTTTGGCGCATGAGCCGGGATAGTAGGTACTGCCCTAAGCCTCCTCATTCGAGCAGAACTAGGCCAACCTGGAGCCCTTCTAGGAGACGACCAAATCTACAACGTAGTCGTCACAGCCCATGCTTTCGTAATAATCTTCTTCATAGTCATGCCAATTATAATCGGAGGGTTTGGAAACTGACTAGTCCCCCTAATAATTGGAGCCCCAGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTACTCCCCCCATCCTTCCTTCTCCTCCTAGCATCCTCTACAGTGGAAGCAGGTGCTGGGACAGGATGAACTGTATACCCGCCACTAGCTGGCAACCTAGCCCACGCCGGAGCCTCCGTCGACCTTGCAATCTTCTCCCTACATCTAGCTGGCATCTCTTCAATTCTAGGGGCAATCAACTTCATTACCACAGCCATCAACATAAAACCGCCCGCCCTGTCACAATACCAAACTCCCCTGTTCGTCTGATCCGTCTTAATTACTGCAGTCCTACTGCTCCTGTCCCTACCAGTTCTCGCCGCAGGAATCACAATACTTCTCACAGACCGCAACCTTAACACCACATTCTTTGACCCTGCTGGAGGAGGAGACCCCGTCCTGTACCAACACCTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Thraupis episcopus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 23
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5