Articles on this page are available in 1 other language: Spanish (8) (learn more)

Overview

Distribution

Caracaras are present along the Mexican - American Border, from Baja California to Eastern Texas, then south to Panama. There are also isolated populations in Cuba, the Isle of Pines, Louisiana, and in Central Florida

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) RESIDENT: in central and southern Florida, Cuba, and the Isle of Pines, and from northern Baja California, southern Arizona, Sonora, Sinaloa, Zacatecas, Nuevo Leon, central and southern Texas, and southwestern Louisiana, south locally through Central America and throughout most of South America, south to northern and central Peru and northern Brazil. Casual north to central New Mexico and southwestern Mississippi. Records from Washington, Oregon, and California, and north to Wyoming, Ontario, Pennsylvania, New York, and New Jersey are of individuals of "questionable origin" (AOU 1998, 2000).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Amazon basin to e Peru, Tierra del Fuego and Falkland Islands.
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

The crested caracara is about the same size as an osprey, but it has shorter wings. It has a length of approximately 53 to 58 centimeters, with a wingspan of approximately 1.2 meters. Caracaras can be identified by thier long yellow legs, and their large, hooked, bluish bill. Caracaras have black crowns and crests, with red facial skin. Thier tails are banded, alternating black and white, with a wide black terminal band. The ends of the primaries and at the base of the neck are also banded. Immature birds appear similar, but their coloring is duller overall. Both sexes of the birds are similarily plumaged.

Other Physical Features: endothermic ; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 58 cm

Weight: 953 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

No other similar bird has all of the following characteristics: black crown, white neck, black belly, whitish tail with black band at end, and a white patch at the end of the dark wings.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Polyborus plancus pallidus
Catalog Number: USNM 156715
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds
Sex/Stage: Male; Adult
Preparation: Skin: Whole
Collector(s): E. Nelson & E. Goldman
Year Collected: 1897
Locality: Maria Madre Island, Tres Marias Islands, Nayarit, Mexico, North America
  • Type: Nelson. January 27, 1898. Proc. Biol. Soc. Washington. 12: 8.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The crested caracaras are birds of open countryside. Their typical habitats are either comprised of dry prairie with some wetter areas or agricultural environments. Caracaras spread themselves thinly over a wide area, with each pair maintaining a large territory.

Terrestrial Biomes: savanna or grassland

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Open country, including pastureland, cultivated areas, and semidesert, in both arid and moist habitats but more commonly in the former (AOU 1983); also coastal lowlands and beaches in some areas. Often occurs on the ground in company of vultures (National Geographic Society 1983).

Florida: associated with open country; dry prairie with scattered cabbage palms (SABAL PALMETTO), wetter prairies, and to some extent also improved pastures and sometimes even rather wooded areas having associated limited areas of open grassland (Johnsgard 1990); center of range is the Kissimmee Prairie, an area of shallow ponds and sloughs with scattered hummocks of live oaks and cabbage palms (see Johnsgard 1990).

Nests in trees, usually in site concealed among branches or palm fronds (often in cabbage palm in Florida, oak or YUCCA in Texas), or in cacti; 2.5-15+ m above ground. In treeless areas may nest on rock ledge or under overhanging rocks, or on ground in secluded site such as marsh island. In Texas, typically nests in brush or woodlands on prairies or hill slopes (Oberholser 1974). Nests often are reused from year to year (Johnsgard 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

The caracara is an opportunistic feeder, its diet consists of both carrion and living prey. The living prey is usually small turtles, turtle eggs, fish, insects, frogs, lizard, snakes, small birds, and some small mammals. Sometimes, when trying to capture a larger animal, pairs will unite their forces. Caracaras have also been observed eating with vultures.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Feeds opportunistically on carrion (and associated insect larvae), various live vertebrates, insects, and worms (Bent 1938, Evans 1982). Commonly utilizes road kills. May "rob" food from vultures. See Palmer (1988) for accounts of predation on eggs of birds and turtles. Pairs may hunt together.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Comments: Total population size is very large but unknown. Using 1986 Christmas Bird Count data, Johnsgard (1990) estimated the U.S. population at 2280 birds, with nearly all of these in Texas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Maintains large territory, usually with mate. In Florida, home range width for breeding adults varied from 4.6-9.8 kilometers, average 6 kilometers (Morrison 1996). Most activity occurred within 2-3 kilometers of nest (Morrison 1996). May aggregate (especially at carrion) in groups of up to about 10 in nonbreeding season. Prebreeders occasionally form aggregations (Palmer 1988). Density was estimated at 4.8 birds per 40 ha in eastern Mexico (see Johnsgard 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Range lifespan

Status: wild:
25.8 (high) years.

Average lifespan

Status: wild:
211 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 37.6 years (captivity) Observations: A specimen of a Brazilian caracara classified as *Polyborus tharus* lived 37.6 years in captivity (Flower 1938). Record longevity in the wild is 17.6 years (http://www.pwrc.usgs.gov/BBL/homepage/longvrec.htm).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Bonds between adult caracaras are strong, persisting until one of the mates dies. Together, the pair of caracaras will maintain a large territory. The nesting site is usually in a cabbage palm tree, and the nest is a bulky structure made with slender vines and sticks. The breeding season for caracaras is from January to March, and the usual clutch being two or three eggs. Incubation is about 32 days, and the young do not leave the nest until they are at least eight weekes old. The family of caracaras can be observed together for at least three months after the young fledge. There is usually only one brood, but two are not unusual.

Key Reproductive Features: iteroparous ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Egg dates: late December-early April (mainly late January-February) in Florida (but nestling several weeks old has been observed in late December), late January-early June (peak March-April) in Texas, March-August in Mexico, mostly dry season in Colombia. Clutch size usually is 2-3. Incubation lasts about 30-32 days, by both sexes but probably mostly by female. Young are tended by both parents, leave nest at about 8 weeks; Johnsgard (1990) questioned that the nestling period is this long. Family stays together about 2-3 months after fledging. Usually one brood each season.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Caracara plancus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CTTATACCTACTCTTCGGAGCATGAGCCGGTATAGTTGGCACCGCCCTTAGCCTACTCATCCGTGCAGAACTAGGCCAACCCGGAACTCTCCTGGGAGACGACCAAATTTACAACGTAATCGTCACCGCCCATGCCTTCGTAATAATTTTCTTCATAGTAATGCCTATCATAATCGGCGGCTTTGGAAACTGATTAGTCCCCCTTATAATCGGTGCCCCAGACATAGCATTCCCCCGAATAAACAACATAAGCTTCTGACTCCTACCCCCATCCTTTCTCCTACTACTAGCCTCCTCCACAGTAGAAGCTGGAGTCGGTACCGGATGAACCGTATACCCTCCCCTAGCAGGCAACCTAGCCCACGCCGGCGCCTCAGTAGACTTGGCCATCTTCTCCCTCCACTTAGCAGGAGTATCCTCCATCCTAGGGGCAATCAACTTCATCACAACAGCTATCAACATAAAACCACCAGCCCTCTCACAGTACCAAACCCCCCTCTTTGTCTGATCTGTACTTATCACTGCTGTCCTCCTCCTACTCTCACTACCAGTTCTTGCCGCAGGCATTACCATACTGCTAACCGACCGAAACCTAAACACCACATTCTTCGACCCAGCCGGCGGAGGCGATCCTATCCTATACCAACACCTATTCTGATTCTTCGGCCACCCTGAAGTCTACATCCTAATCCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Caracara plancus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Not Recognized (NR)
  • Not Recognized (NR)
  • Not Recognized (NR)
  • Not Recognized (NR)