Articles on this page are available in 2 other languages: Chinese (Simplified) (10), Dutch (1) (learn more)

Overview

Brief Summary

Magpies have the reputation for eating lots of eggs and young birds. Although they do like eggs, this is only a small part of their diet. Nor is the number of songbirds declining due to them. Magpies like large insects the most, followed by berries and seeds. They build their nests high up in trees early in spring. The nest is an ingenious construction made from branches. The nests have a roof, making it much taller than a crow's nest.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

This much maligned bird is widely disliked because of its feeding habits; magpies occasionally take bird eggs and chicks, small mammals and even adders (6). Yet they are often beneficial birds, perching on livestock and ridding them of ticks, and feeding mainly on pest insects (6), other invertebrates and vegetable matter (7). Magpies hoard food in holes in the ground during winter (7). They are notorious thieves, taking clothes pegs and other brightly coloured objects from gardens (6). Magpies are sociable birds, gathering in groups to roost, and occasionally forming noisy gatherings called 'magpie parliaments' (4) in the first few weeks of the year. It is thought that these gatherings are 'crow marriages', which allow unpaired birds to find a mate before the approaching breeding season (6). During spring, territories are defended, and fights may ensue. Both sexes help to construct the large roofed nest; the male brings nesting material while the female arranges it. 5-7 eggs are laid in April or May, and incubated for up to 18 days (6). After hatching, the chicks stay in the nest for 22-27 days, and rely on their parents for food for up to 8 weeks after leaving the nest. The fledglings stay with their parents throughout autumn and winter (6). There are many folk stories involving the magpie; it is thought to be associated with the devil in many parts of the country, and crossing oneself upon seeing one or saluting lone magpies is a practice that continues to this day in some areas. The magpie rhyme varies greatly, but usually begins: one for sorrow, two for joy (4). It is believed that the magpie refused to mourn Christ at the crucifixion, it is also said that the magpie refused to enter Noah's ark, instead sitting on the roof and swearing for the duration of the deluge (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

The common magpie is an unmistakable species with its black and white plumage, and iridescent green or blue glossy sheen (2). The tail is long, and is usually longer in males than females (2). Its harsh voice includes a fast chattering alarm call; the 'mag' part of the common name used to mean 'chatterer' (4), and was added to 'pie' (referring to the black and white 'pied' colouring) in the 16th century (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Description of Pica pica

De \'\'Ekster\'\' (\'Pica pica\') is een vogel die behoort tot de familie van kraaiachtigen. ==Verschijning en gewoonten== Met zijn opvallende zwart-witte verenkleed is de ekster een van de gemakkelijkst te herkennen vogels. De vogel is meestal in bomen te vinden, waar hij ook zijn grote nest in bouwt van takken. Zoals alle kraaiachtigen is de ekster een omnivoor die vooral in het voorjaar nesten van andere vogels leegrooft; de aanwezigheid van eksters gaat dan ook meestal met veel alarm van andere vogels gepaard.  Eksters 46 cm. Gemakkelijk herkenbaar door contrasterend zwart en wit verenkleed en lange staart, die de helft van lichaamslengte uitmaakt. Staart van mannetje langer dan van vrouwtje. Flanken, buik en schouders puur wit; rest van verenkleed, snavel en poten zwart. Staart- en vleugelveren met opvallende metaalachtige glans, vooral in zonlicht. Juveniel lijkt sterk op adult, maar heeft kortere staart. Houdt van kleurige en glimmende voorwerpen, welke naar het nest gebracht worden.
Creative Commons Attribution 3.0 (CC BY 3.0)

Quest

Source: BioPedia

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range

Various races of the magpie Pica pica occur throughout Europe and Asia, reaching as far south as the Mediterranean and the Himalayas (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Occurs in a broad range of habitats (7), but tends to breed around farms and villages and in urban areas (2) where there are trees, shrubs and open areas (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Known prey organisms

Pica pica preys on:
Agelaius phoeniceus

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 21.7 years (wild) Observations: Oldest banded individual was 21.7 years-old (http://www.euring.org/data_and_codes/longevity.htm).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pica pica

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 16 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTTTTCTCCAACCCACAAAGACATTGGCACTCTGTACCTAATCTTCGGAGCATGAGCCGGAATAGTAGGTACCGCCCTAAGTCTTCTTATCCGAGCAGAACTAGGCCAACCCGGTGCCCTGCTAGGAGACGACCAAATCTACAATGTTATCGTTACAGCTCATGCTTTCGTCATAATCTTCTTCATAGTAATACCAATTATGATCGGAGGGTTCGGAAACTGACTAGTACCCCTAATAATTGGTGCCCCGGACATAGCCTTCCCACGAATAAACAATATAAGCTTCTGACTTCTTCCTCCCTCATTCCTTCTCCTACTAGCCTCCTCTACAGTAGAAGCAGGAGCAGGCACAGGATGAACCGTATATCCCCCACTAGCTGGTAACCTAGCCCATGCTGGGGCTTCAGTAGACCTAGCCATTTTCTCACTACATCTAGCAGGTATCTCATCTATTCTAGGGGCAATCAACTTCATCACCACAGCAATTAATATAAAACCCCCAGCACTATCACAATATCAAACTCCTCTATTTGTATGATCCGTACTAATCACCGCAGTACTGCTTCTTCTATCCCTTCCTGTCCTTGCCGCTGGAATTACTATGCTCCTAACAGACCGTAACCTTAACACTACATTCTTCGATCCAGCAGGAGGAGGAGACCCAGTACTATATCAACACCTATTCTGATTCTTCGGACACCCAGAAGTCTACATCCTAATTCTACCAGGATTTGGAATTATCTCCCACGTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Pica pica

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 24
Specimens with Barcodes: 27
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2015

Assessor/s
BirdLife International

Reviewer/s
Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2012
    Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5