Articles on this page are available in 2 other languages: Arabic (32), Chinese (Simplified) (8) (learn more)

Overview

Brief Summary

Biology

Ravens are well-known for their intelligence, they are also very playful birds, performing mid-air acrobatics, playing 'games' with each other's beaks and passing stones to each other (5). They eat a wide variety of food, including carrion, small vertebrates, insects and refuse, yet carrion is the most important component of the diet (6). Pairs stay together for life, and defend a territory from which they exclude all other ravens (5). Breeding begins in February or March. Following a mating display involving posturing, mutual preening and beak caressing, the pair make a solid nest (or renovate the previous year's nest) of sticks lined with moss and mud (5). Clutches contain 4-6 blue-green eggs, one of which is laid each day until the clutch is complete (5). The female incubates the eggs for up to 20 days, during which time she is fed by the male (5). Both parents feed the chicks, which stay in the nest for up to six and a half weeks (5). Ravens do not tend to travel widely; during winter adults remain in their breeding territory, and young birds do not tend to disperse further away than 20 miles (5). A rich wealth of folklore and mythology centres on the raven; King Arthur is said to return in the form of a raven, Noah sent out a raven from the Ark to fly 'forth and fro until the waters were dried up from off the earth', and the Norse god Odin had two ravens who flew the world to return to his shoulders and whisper what was happening into his ears (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Description

The raven is a magnificent bird; bigger than a buzzard, it is the largest passerine (perching) bird in Europe (2), and is deeply embedded in mythology (4). The glossy plumage is entirely black with greenish and lilac sheens. The large bill is very thick and heavy looking (2), the wings are narrow, and the tail is wedge-shaped (2). The sexes are similar in appearance, but females are somewhat smaller than males (5). Juveniles are duller than adults, and have a variable amount of brown in the plumage (5).  A variety of vocalisations are produced, including a 'korrp' call and a 'krack-krack-krack' of alarm. In spring and during courtship, a range of unusual sounds can be heard such as clucks, a 'klong' and pops (2)(5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Comprehensive Description

Description of Corvus corax

Raven 62 cm. De grootste kraai. Heeft zeer krachtige snavel, geheel zwart, glanzend verenkleed en verlengde keelveren, die ruig uiterlijk veroorzaken. Juveniel heeft bruinig, niet glanzend, zwart verenkleed. Altijd te onderscheiden van Zwarte Kraai door groot formaat, enorme snavel, \'ruige\' keel, wigvormige staart en geluid. Heeft krachtige vlucht met langzame vleugelslagen; zweeft vaak langdurig (andere kraaien niet) en haalt in de lucht acrobatische toeren uit, met name tijdens broedseizoen.
Creative Commons Attribution 3.0 (CC BY 3.0)

Quest

Source: BioPedia

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Common ravens are one of the most widespread, naturally occurring birds worldwide. They are found in northern Europe, the British Isles, Greenland (mainly coastal areas), Iceland, northern Scandinavia, east through central Asia to the Pacific Ocean and south to the Himalayas and northwestern India, Iranian region and near east, northwestern Africa and the Canary Islands, and North and Central America as far south as Nicaragua.

Biogeographic Regions: nearctic (Native ); palearctic (Native ); oriental (Native ); neotropical (Native )

Other Geographic Terms: holarctic

  • Boarman, W., B. Heinrich. 1999. Corvus corax: Common Raven. The Birds of North America, 476: 1-32.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: Resident from northernmost North America south to southern Baja California, Nicaragua, Texas, and, east of Rockies, southern Saskatchewan, northeastern Minnesota, northern Michigan, southern New England (Flanagan 1993), and in Appalachians, locally south to northern Georgia. Also in Greenland, Iceland, North Africa, Europe, and Asia.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Common ravens are are one of the most widespread, naturally occurring birds worldwide. They are found throughout most of North America, into Central America, Europe, Asia, and northern Africa. They are native to the Nearctic and Palearctic regions.

Biogeographic Regions: nearctic (Native ); palearctic (Native ); oriental (Native ); neotropical (Native )

Other Geographic Terms: holarctic

  • Boarman, W., B. Heinrich. 1999. Corvus corax: Common Raven. The Birds of North America, 476: 1-32.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

The raven is found only in rural parts of its former range (8); in Britain it is restricted to the west and north (6). It also occurs in Europe, northern Africa, Asia (except south and southeast Asia), Greenland, Iceland, North America and Australia (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Common ravens are large, black birds with a wedge-shaped tail. They have a well-developed ruff of feathers on the throat, which are called 'hackles' and are used often social communication. These are the largest passerines. Adults reach up to 69 cm in length and from 689 to 1625 grams in weight. They are generally distinguished from other Corvus species by their large size, more wedge-shaped tail, robust bill, a tendency to soar and glide, and their frequent, harsh, croaking calls.  The sexes are generally alike, although females may be smaller.

Range mass: 689 to 1625 g.

Range length: 69 (high) cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike

Average basal metabolic rate: 5.5656 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Common ravens are large, black birds with a wedge-shaped tail. They have long feathers on their throats, which are called 'hackles'. Common ravens are the largest species of perching birds (passerines). Adults reach up to 69 cm in length and from 689 to 1625 grams in weight. They can be distinguished from other Corvus species by their large size, more wedge-shaped tail, thick bill, a tendency to soar and glide, rather than flap their wings (as in Corvus brachyrhynchos), and their harsh, croaking calls.  The sexes are generally alike, although females may be smaller.

Range mass: 689 to 1625 g.

Range length: 69 (high) cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike

Average basal metabolic rate: 5.5656 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 61 cm

Weight: 1240 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 11 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 9.756 - 11.855
  Nitrate (umol/L): 5.451 - 6.485
  Salinity (PPS): 35.157 - 35.184
  Oxygen (ml/l): 6.128 - 6.351
  Phosphate (umol/l): 0.418 - 0.505
  Silicate (umol/l): 2.656 - 3.285

Graphical representation

Temperature range (°C): 9.756 - 11.855

Nitrate (umol/L): 5.451 - 6.485

Salinity (PPS): 35.157 - 35.184

Oxygen (ml/l): 6.128 - 6.351

Phosphate (umol/l): 0.418 - 0.505

Silicate (umol/l): 2.656 - 3.285
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Common ravens prefer open landscapes, such as treeless tundra, seacoasts, open riverbanks, rocky cliffs, mountain forests, plains, deserts, and scrubby woodlands. However, these ravens can be found in most types of habitats except for rainforests. Common ravens in North America tend to be found in wild areas, whereas their cousins, common crows tend to be found in areas more affected by human habitation. In some parts of their range they have become quite habituated to humans and can be found in urban areas.

Common ravens generally roost on cliff ledges or in large trees but have also established nests on power-lines, in urban areas, and on billboards, to name only a few.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: tundra ; taiga ; desert or dune ; savanna or grassland ; chaparral ; forest ; scrub forest ; mountains

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Various situations from lowlands to mountains, open country to forested regions, and humid regions to desert; most frequently in hilly or mountainous areas, especially in vicinity of cliffs (AOU 1983). Closely associated with humans along Beaufort Sea coast of Alaska (Johnson and Herter 1989).

Nests usually on cliff ledges or in coniferous trees, also on man-made structures. See White and Tanner-White (1988) for information on the use of highway overpasses and billboards for nesting in Idaho and Utah. Often reuses nests in successive years.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Common ravens prefer open landscapes, such as treeless tundra, seacoasts, open riverbanks, rocky cliffs, mountain forests, plains, deserts, and scrubby woodlands. However, these ravens can be found in most types of habitats except for rainforests. Common ravens in North America tend to be found in wild areas, whereas their cousins, Corvus brachyrhynchos tend to be found more in cities and suburbs.

Common ravens generally roost on cliff ledges or in large trees but have also established nests on power-lines, in urban areas, and on billboards, to name only a few.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: tundra ; taiga ; desert or dune ; savanna or grassland ; chaparral ; forest ; scrub forest ; mountains

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 11 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 9.756 - 11.855
  Nitrate (umol/L): 5.451 - 6.485
  Salinity (PPS): 35.157 - 35.184
  Oxygen (ml/l): 6.128 - 6.351
  Phosphate (umol/l): 0.418 - 0.505
  Silicate (umol/l): 2.656 - 3.285

Graphical representation

Temperature range (°C): 9.756 - 11.855

Nitrate (umol/L): 5.451 - 6.485

Salinity (PPS): 35.157 - 35.184

Oxygen (ml/l): 6.128 - 6.351

Phosphate (umol/l): 0.418 - 0.505

Silicate (umol/l): 2.656 - 3.285
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Occurs in a range of habitats, but seems to prefer upland areas, moorland, and coastal cliffs (6), as well as wooded lowlands (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Basically sedentary, but some migration has been reported for birds in the most northern part of the range.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Common ravens are mainly scavengers. They eat a wide array of animal foods, including arthropods, amphibians, small mammals, birds, reptiles, and carrion. They are attracted to carrion and eat also the insects that feed on carrion (chiefly on maggots and beetles). They are also known to eat the afterbirth of ewes and other large mammals. Vegetable foods include grains, acorns, fruits, and buds. Stomach analyses show that the diet is made up primarily of mammalian flesh, followed by insects and birds. Common ravens take their food from the ground and will store foods of all kinds, including nuts, bones, eggs, and meat. Young ravens begin to experiment with caching edible and non-edible objects soon after leaving the nest.

Animal Foods: birds; mammals; amphibians; reptiles; eggs; carrion ; insects; terrestrial non-insect arthropods

Plant Foods: seeds, grains, and nuts; fruit

Foraging Behavior: stores or caches food

Primary Diet: carnivore (Scavenger )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Opportunistic; in some areas, largely a scavenger on various animals; also commonly eats bird eggs and young, rodents, some fruits, cereal grains, insects.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Common ravens are omnivorous. They eat a wide array of animal foods, including Insecta, Araneae, Amphibia, small Mammalia, birds, Squamata, and carrion. They are attracted to carrion and eat also the insects that feed on carrion (chiefly on Diptera and Coleoptera). They are also known to eat the afterbirth of ewes and other large mammals. Vegetable foods include grains, acorns, fruits, and buds. By looking at raven stomach contents, researchers have shown that the most important food source for common ravens is mammal flesh, probably in the form of carrion. Insects and birds are also important food sources. Common ravens take their food from the ground and will store foods of all kinds, including nuts, bones, eggs, and meat. As soon as young ravens leave the nest they begin experimenting with hiding foods in storage areas.

Animal Foods: birds; mammals; amphibians; reptiles; eggs; carrion ; insects; terrestrial non-insect arthropods

Plant Foods: seeds, grains, and nuts; fruit

Foraging Behavior: stores or caches food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Common ravens consume carrion, thereby helping in nutrient cycling. They are also important predators of arthropods, mammals, and birds in the ecosystems in which they live.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Common ravens are rarely observed being preyed on, even as eggs or young in the nest. Predators on nestlings may include large hawks and eagles, other ravens, owls, and martens. Golden eagles, great horned owls, and coyotes have been observed attacking nests and fledglings. Adults are usually successful at defending their young and will vigorously chase predators away. Adults are wary of approaching novel kinds of carrion and new situations and will often only approach after the presence of blue jays and American crows makes it clear that no danger is near.

Known Predators:

  • birds of prey (Falconiformes)
  • owls (Strigiformes)
  • American martens (Martes americana)
  • golden eagles (Aquila chrysaetos)
  • great horned owls (Bubo virginianus)
  • coyotes (Canis latrans)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecosystem Roles

Common ravens help to recycle nutrients into the ecosystem by eating the carcasses of dead animals. They are also important predators.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Common ravens are not often preyed on, even as eggs or young in the nest. Predators on nestlings may include large Falconiformes, other ravens, Strigiformes, and Martes americana. Aquila chrysaetos, Bubo virginianus, and Canis latrans have been observed attacking nests and fledglings. Adults are usually successful at defending their young and will chase predators away. Common ravens are careful at foraging areas and will only approach new types of carrion or new situations after reassuring themselves that no predator is nearby.

Known Predators:

  • Falconiformes
  • Strigiformes
  • Martes americana
  • Aquila chrysaetos
  • Bubo virginianus
  • Canis latrans

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Corvus corax is prey of:
Strigiformes
Aquila chrysaetos
Bubo virginianus
Martes americana
Canis latrans
Falconiformes

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Corvus corax preys on:
Arthropoda
Insecta
Amphibia
Reptilia
Aves
Mammalia
Egretta tricolor
Branta canadensis
Anser anser
Anas cyanoptera
Parabuteo unicinctus
Asio flammeus
Chordeiles minor

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

May roost communally in groups of up to several hundred individuals (e.g., see Wilson Bull. 104:105-121).

Home range size of breeding birds was 0.2-4.4 square kilometers in coastal California, where ranges of nesting pairs sometimes overlapped; breeding season home range averaged 6.6 square kilometers in Utah, 9.4 square kilometers in Wyoming (see Linz et al. 1992). Territories in Minnesota were much larger, averaging 40.5 square kilometers (Bruggers 1998).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Common ravens are very vocal animals, with a diverse suite of calls and non-vocal sounds for different purposes and social contexts. From 15 to 33 categories of vocalizations have been described in this species. There are alarm calls, comfort sounds, chase calls, and calls designed for advertising territories. Common ravens may be able to mimic sounds of other animals but this has not been unambiguously documented. It is also possible that they are simply capable of a huge diversity of sounds and innovation enough to create calls that sound like those of others. Young birds engage in vocal play, in which they seemingly go through their entire repertoire of sounds, pitches, and volumes for minutes or hours at a time. Non vocal sounds include wing whistles and bill snapping.

Common ravens also communicate with physical displays of either threat or appeasement to subordinate and dominant ravens. Territorial pairs chase intruders for several kilometers and may engage in aerial fights. Tactile cues via allopreening are also used. Common ravens perceive their environment through vision, some chemical cues, tactile, and auditory stimuli.

Communication Channels: visual ; tactile ; acoustic

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Communication and Perception

Common ravens make many different kinds of calls for communication. They often seem to be speaking or mimicing the sounds of other animals because they are capable of making so many different kinds of sounds. They also make alarm calls, advertise their territories by calling, and make comforting sounds. They also use physical displays to either threaten or appease other ravens.

Communication Channels: visual ; tactile ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

A wild raven was recorded living for 13 years and 4 months. Captive birds may live much longer, one captive individual was recorded to have lived 80 years and captives at the Tower of London in England live for 44 years or more. Probably most common ravens die during their first few years of life.

Range lifespan

Status: wild:
13 (high) years.

Range lifespan

Status: captivity:
>44 (high) years.

Typical lifespan

Status: captivity:
44 (high) years.

Average lifespan

Status: wild:
206 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan/Longevity

A wild raven was recorded living for 13 years and 4 months. Captive birds may live much longer, captives at the Tower of London in England live for 44 years or more. Probably most common ravens die during their first few years of life.

Range lifespan

Status: wild:
13 (high) years.

Range lifespan

Status: captivity:
>44 (high) years.

Average lifespan

Status: wild:
206 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 69 years (captivity) Observations: One captive specimen reportedly survived to 69 years of age (Holmes and Ottinger 2003). The lifespan of ravens in captivity, however, could be above 70 years with one anecdotal report of one raven living up to 80 years of age in captivity. In the wild, most ravens are short-lived with the record being held by a 21.9 year-old individual (http://www.euring.org/data_and_codes/longevity.htm).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

There is little information on when or how pair formation occurs. Displays occur between individuals throughout the year, some of which may be courtship. These displays are most intense in the fall and winter. There is evidence that pairs stay together throughout the year but no concrete evidence that mating occurrs for life. Females invite copulation by crouching slightly or opening, extending, or drooping their wings and shaking or quivering a slightly raised tail.

Mating System: monogamous

Breeding and egg laying occurs between mid-February and late May, though most clutches are started in March or April. Breeding season varies by region and by the length of the winter. Usually 3 to 7 eggs are laid per nest and incubated for 20 to 25 days. Nests are made mostly of sticks, are asymmetrical, and measure 40 to 153 cm diameter by 20 to 61 cm high at the base and 22 to 40 cm diameter by 13 to 15 cm deep in the cup. Young leave the nest between 5 and 7 weeks of age. They may then leave the area, and their family, within a week or may remain with the parents for a more extended period of time. Sexual maturity is reached at about 3 years of age.

Breeding interval: Common ravens breed once yearly.

Breeding season: Breeding occurs in lmid-February through May.

Range eggs per season: 3 to 7.

Range time to hatching: 20 to 25 days.

Range time to independence: 5 to 7 weeks.

Average age at sexual or reproductive maturity (female): 3 years.

Average age at sexual or reproductive maturity (male): 3 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Average eggs per season: 5.

Average age at sexual or reproductive maturity (male)

Sex: male:
1095 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
1095 days.

Females exclusively incubate the eggs but both parents care for the young once they have hatched.

Parental Investment: no parental involvement; altricial ; pre-fertilization (Protecting: Female); pre-hatching/birth (Protecting: Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female); post-independence association with parents; extended period of juvenile learning

  • Boarman, W., B. Heinrich. 1999. Corvus corax: Common Raven. The Birds of North America, 476: 1-32.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Clutch size is 3-7 (usually 3-6). Incubation is entirely or mostly by female (fed by male), 18-21 days. Young are tended by both parents, leave nest in 5-6 weeks. When food supply is limited, smallest chick often does not survive. Young remain with parents for several weeks after fledging.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Common ravens spend a lot of time doing various kinds of displays towards each other, some of these may be courtship displays. They probably find mates during the fall or winter of their first year and stay together for at least a few years and perhaps for life.

Mating System: monogamous

Common ravens lay their eggs and begin incubating them between mid-February and late May, depending on the length of the winter. Usually 3 to 7 eggs are laid per nest and incubated for 20 to 25 days. The young leave the nest at 5 to 7 weeks old. After leaving the nest they often stay around their parents for longer, being fed and learning more about their environment.

Breeding interval: Common ravens breed once yearly.

Breeding season: Breeding occurs in lmid-February through May.

Range eggs per season: 3 to 7.

Range time to hatching: 20 to 25 days.

Range time to independence: 5 to 7 weeks.

Average age at sexual or reproductive maturity (female): 3 years.

Average age at sexual or reproductive maturity (male): 3 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization (Internal )

Average eggs per season: 5.

Average age at sexual or reproductive maturity (male)

Sex: male:
1095 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
1095 days.

Females incubate the eggs but both parents care for the young once they have hatched.

Parental Investment: altricial ; male parental care ; female parental care

  • Boarman, W., B. Heinrich. 1999. Corvus corax: Common Raven. The Birds of North America, 476: 1-32.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Corvus corax

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 20 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCCACAAAGACATTGGCACTCTGTACCTAATCTTCGGAGCATGAGCCGGAATAGTAGGTACCGCCCTAAGTCTCCTTATCCGGGCAGAACTAGGCCAACCAGGCGCTCTGCTAGGAGACGACCAAATCTACAATGTAATCGTTACAGCCCACGCTTTCGTTATAATCTTCTTCATAGTGATACCAATCATAATCGGGGGATTTGGAAACTGACTAGTTCCTCTAATGATTGGTGCCCCAGATATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTCCTACCACCCTCATTCCTTCTCCTCCTAGCCTCTTCCACAGTAGAAGCAGGAGCAGGAACAGGATGAACTGTATACCCACCACTGGCTGGTAACCTAGCCCACGCTGGAGCCTCAGTCGACCTAGCTATCTTCTCACTACATCTAGCAGGTATTTCCTCTATCCTAGGGGCAATTAACTTCATTACCACAGCAATCAACATAAAACCTCCAGCCCTATCACAATACCAAACCCCTCTATTCGTGTGATCCGTACTAATTACCGCAGTACTACTCCTTCTCTCCCTACCCGTACTTGCCGCCGGAATCACTATGCTTCTAACAGACCGAAACCTCAATACCACATTCTTTGACCCAGCAGGTGGAGGAGACCCAGTACTATACCAACATCTATTCTGATTCTTTGGACACCCAGAAGTTTATATCCTAATTCTACCAGGATTTGGAATTATCTCCCACGTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Corvus corax

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 22
Specimens with Barcodes: 31
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2014

Assessor/s
BirdLife International

Reviewer/s
Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2012
    Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5