Articles on this page are available in 1 other language: Chinese (Simplified) (7) (learn more)

Overview

Comprehensive Description

Longueur moyenne : 61 cm (mâles) à 67 cm (femelles), envergure moyenne : 157 cm (mâles) à 168 cm (femelles), poids : 1 600 à 2 800 g pour les mâles et 1 800 à 4 200 g pour les femelles.

Le Grand-duc d’Europe possède un corps massif : c’est le plus grand rapace nocturne du monde et il est deux fois plus gros qu’une Chouette hulotte. Il se distingue par sa grosse tête ornée d’aigrettes de 8 cm de long et par ses grands yeux jaune orange. Le plumage est brun-roux tacheté et barré de sombre sur le dessus. Le dessous est rouille couvert de raies brun foncé finement barrées de sombre. Quand l’oiseau émet un appel bec fermé, sa gorge enfle et fait apparaître une tâche blanche qui agit comme un signal optique dans l’obscurité. En vol, les ailes sont longues et larges.

Sur une courte distance, le Grand-duc d’Europe se déplace par bonds en retombant lourdement sur ses pattes. En vol, il est très agile et peut être rapide malgré sa taille. Il vole généralement au ras du sol dans les milieux ouverts mais peut aussi survoler les larges vallées à grande hauteur.

La phase d’activité commence au crépuscule puis se poursuit la nuit avec une baisse après minuit. Selon le contexte (site tranquille) et la période (famine, nourrissage des jeunes), ils peuvent être actifs le jour.
Les Grands-ducs sont très tolérants entre eux. Seul un territoire proche du nid est défendu. Le Grand-duc est en revanche très agressif à l’égard des autres rapaces diurnes et nocturnes.

Les couples se forment en octobre. En dehors de la parade nuptiale qui a lieu en février/mars, les conjoints ne cherchent pas un contact étroit, possèdent des reposoirs séparés et volent chacun de leur côté. La femelle pond 2 ou 3 œufs qu’elle couve seule pendant 34 jours. Selon son emplacement, les poussins quittent ensuite le nid entre l’âge de 3,5 (nid au sol) à 10 semaines (paroi rocheuse). Les premières tentatives de vol ont lieu vers la 8ème semaine. Ils acquièrent une autonomie de chasse après l’âge de 80 jours et à ce moment-là ils dispersent, sur 50 km en moyenne.

Les rongeurs tiennent une part importante du régime alimentaire. Cependant, cet oiseau est opportuniste, il s’attaque en priorité aux proies « faciles » (vertébrés affaiblis, blessés, charognes, ...). Il est capable de prélever des corvidés, rapaces diurnes et nocturnes, pigeons, hérissons, lagomorphes. En fonction du contexte, il peut capturer aussi des renards, chauves-souris, grenouilles, lézards, poissons, invertébrés. Il peut chasser à l’affut, en rase-motte, le long de parois rocheuses voire à pied. Ses pelotes de réjection mesurent en moyenne 72 mm de long et 34 mm de diamètre ; compte tenu de leur taille, elles ne peuvent être confondues avec celles d’aucun autre rapace nocturne.

Le Grand-duc d’Europe est une espèce sédentaire. Il utilise toujours les mêmes lieux pour dépecer ses proies et les entreposer. Néanmoins, la fidélité au territoire ainsi qu’au couple ne durent pas toute la vie.

Le Grand-duc d’Europe fréquente des habitats très variés : les falaises jouxtant les grandes étendues d’eau, les bords de mer, les garrigues du bassin méditerranéen. Il chasse essentiellement en milieu ouvert ou peu boisé. Pour nicher, il préfère les parois rocheuses et les carrières pourvues de cavités et de surplombs. Il recherche généralement la proximité de l’eau pour boire, se baigner et y trouver de nombreuses proies.

Manifestation vocale : Chant territorial du mâle puissant mais étouffé composé de deux syllabes bouho avec accent sur la première. Chant de la femelle, ouhyou, plus aigu plus pressé et plus rauque avec une tonalité moins fluctuante.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Muséum national d'Histoire naturelle. Service du Patrimoine naturel

Source: Inventaire National du Patrimoine Naturel

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Eagle owls primarily live in the Palearctic region, although they can travel as far south as the Oriental Region and Ethiopian Region and as far north as the far reaches of Siberia. They are found in North Africa, Europe, The Middle East, and Asia.

Biogeographic Regions: palearctic ; oriental ; ethiopian

Other Geographic Terms: holarctic ; cosmopolitan

  • Centre for the Conservation of Specialized Species. 2002. "The Eurasian Eagle Owl" (On-line ). The Centre for the Conservation of Specialized Species. Accessed 3/21/03 at http://www.conservationcentre.org/scase21.html.
  • Konig, C., J. Becking, F. Weick. 1999. Owls: A Guide to the Owls of the World. New York, NY: Yale University Press.
  • Parry-Jones, J. 1998. Understanding Owls: Biology, Management, Breeding, Training. New York, NY: David and Charles.
  • The Peregrine Fund. 2003. "Eurasian Eagle Owl" (On-line). The Peregrine Fund. Accessed March 21, 2003 at http://www.peregrinefund.org/Explore_Raptors/owls/eagleowl.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Eagle owls are the largest owls in the world, and they are best known for their large, striking, orange eyes. They are often called the Old World version of America's widely distributed great horned owl. They have prominent ear tufts and are primarily brown-black and tawny-buff in color. Their facial disk is heavily marked with black, gray, and white. Their upper parts are darker than their lower parts, which have black streaks, and their throat is white. It is interesting to note that these owls become paler in the northeastern geographic regions and get progressively darker as you move to the Pacific coast. Also, size tends to decrease from north to south, and east to west.

Range mass: 1600 to 4200 g.

Average mass: 2800 g.

Range length: 58 to 71 cm.

Average length: 65 cm.

Range wingspan: 1.5 to 2 m.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: female larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

These owls can be found in many different kinds of habitats including wooded areas (coniferous forests), warm deserts, mountain ranges, and riverbeds. They prefer to live in rocky landscapes, especially when nesting. Eagle owls search for habitats with adequate food supply and proper nesting sites. Their habitats vary greatly, and they can also be found in open areas that have few trees like farmlands and grasslands.

Habitat Regions: temperate ; polar ; terrestrial

Terrestrial Biomes: tundra ; taiga ; desert or dune ; savanna or grassland ; forest ; scrub forest ; mountains

Wetlands: marsh ; swamp

Other Habitat Features: suburban ; agricultural

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Eagle owls are carnivores. They are primarily nocturnal hunters and have various hunting techniques. They take their prey in flight or on the ground. They prefer to hunt in open spacious locations rather than forests. Most owls are very capable hunters and the eagle owl is no exception. Owl wings have evolved to make very little noise when flapping. With their night vision, advanced hearing, and silent flight they are the hit men of their territory. Their prey usually has no idea they were being stalked. They feed on almost anything they can catch including rats, mice, voles, beetles and even large prey like deer fawns and foxes. They will also feed on other birds such as crows, ducks, and even other owls. Dominant prey can vary from habitat to habitat but is most often small rodents.

Animal Foods: birds; mammals; reptiles; insects

Primary Diet: carnivore (Eats terrestrial vertebrates, Insectivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Eagle owls are at the top of their food chain. They are particularly useful in keeping the number of rodents down in their various ecosystems. The removal of this species can cause the rodent population in a given area to grow significantly. Therefore, they may be a keystone predator.

Ecosystem Impact: keystone species

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Once eagle owls reach adulthood, they are at a very low risk of predation. They are at the top of the food chain in their niche. They are not a major food source for any other species. The only time they are at risk of predation is during their early years. They are at risk from any predator too large for them too eat. Fortunately, the mother stays with the young for most of this period and keeps the predators at bay. Due to their striped, spotted, and varied coloring, they are extremely well camouflaged, especially when perching in the trees.

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Bubo bubo preys on:
Tyto alba
Dryomys nitedula

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Eagle owls are known for their loud calls. They are heard far more than they are seen. They use their various hoots and clucks to let others know they have entered or are entering certain territories. Different hoots represent different moods and are easily recognizable between each member of the species. Also, eagle owls are able to decipher the size and distance of intruders based on the intensity of their call. They also use a low gutteral hoot to attract mates. It's interesting to note that even though eagle owls are difficult to study, they (like other owls) cough up what is known as an owl pellet after their stomach goes through the digestive process. These owl pellets contain the hair, feathers, and bones of prey they were unable to digest. These pellets are very useful to scientists because they help them understand the food habits of these elusive birds.

Communication Channels: visual ; acoustic

Perception Channels: visual ; tactile ; acoustic ; vibrations ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Eagle owls have relatively long life spans once they reach adulthood. They have no real natural enemies. In the wild, they live for approximately 20 years, but they can live more than 60 years in captivity.

Range lifespan

Status: wild:
68 (high) years.

Range lifespan

Status: captivity:
64 (high) years.

Typical lifespan

Status: wild:
10 to 20 years.

Typical lifespan

Status: captivity:
20 to 60 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 68 years (captivity) Observations: In captivity these animals may live over 60 years.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Both sexes are usually solitary but they pair up during courtship. They advertise potential breeding sites by digging a shallow depression into the earth and emitting a light staccato note and various clucking sounds. They also use these calls to keep track of their mate's location. People often hear them calling to each other. They keep the same partners for life. Eagle owls are very sensitive to their environment. If there is not enough food resources, will mate at a much slower rate and later into the year. When they have sufficient habitats and plentiful food, their mating rate increases significantly.

Mating System: monogamous

Eagle owls form pairs in early fall and nest in late January and early February. They prefer to nest in crevices between rocks, sheltered cliff ledges, cave entrances, as well as abandoned nests of other large birds. Usually egg laying begins in late winter. They usually have one batch of eggs per year ranging from one to four white eggs. This number depends on the food availiable in their area. When the owlets hatch, they are brooded for about two weeks. In about three weeks the young begin to feed and swallow by themselves. By week five they can walk around the nesting area and begin to fly about 60 days, although for only a few meters. They leave the nest or are driven out in the fall (Sept-Nov.) Eagle owls are able to breed from the ages of 2-31 years.

Breeding interval: Breeding occurs once a year.

Breeding season: The breeding season lasts from December to April.

Range eggs per season: 1 to 4.

Average eggs per season: 3.

Range time to hatching: 2 to 3 months.

Range fledging age: 20 to 24 weeks.

Range time to independence: 9 to 12 months.

Range age at sexual or reproductive maturity (female): 1 to 3 years.

Range age at sexual or reproductive maturity (male): 1 to 3 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization ; oviparous

Once the eggs are laid, they are incubated by the female alone. The male kills prey and feeds his mate. Once the eggs hatch, the male continues to bring food to the female for the next two weeks. During this time the female stays at the nest protecting her young from predators and teaching them how to eat on their own. All owls are imprinted by their mothers, which means they will imitate the first animal they see. This makes it difficult to release owls into captivity if they are not raised by an owl parent. If an owl sees a human when they are born, they think they are human too.

Parental Investment: male parental care ; female parental care

  • Centre for the Conservation of Specialized Species. 2002. "The Eurasian Eagle Owl" (On-line ). The Centre for the Conservation of Specialized Species. Accessed 3/21/03 at http://www.conservationcentre.org/scase21.html.
  • Konig, C., J. Becking, F. Weick. 1999. Owls: A Guide to the Owls of the World. New York, NY: Yale University Press.
  • Parry-Jones, J. 1998. Understanding Owls: Biology, Management, Breeding, Training. New York, NY: David and Charles.
  • Penteriani, V., M. Gallardo, P. Roche. 2002. Landscape structure and food supply affect eagle owl (Bubo bubo) density and breeding performance: a case of intra-population heterogeneity. Journal of Zoology, 257: 365-372.
  • The Peregrine Fund. 2003. "Eurasian Eagle Owl" (On-line). The Peregrine Fund. Accessed March 21, 2003 at http://www.peregrinefund.org/Explore_Raptors/owls/eagleowl.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Bubo bubo

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TCCAACCACAAAGACATTGGCACCCTCTACCTAATCTTCGGGGCATGAGCAGGCATAGTTGGCACTGCCCTCAGCCTACTTATCCGAGCCGAACTCGGCCAACCCGGGACCCTTCTTGGCGACGACCAAATCTACAACGTAGTTGTCACCGCCCATGCCTTTGTAATAATCTTTTTTATGGTCATACCCATCATGATCGGAGGATTTGGAAACTGATTAGTCCCACTAATAATTGGAGCCCCAGACATAGCCTTCCCCCGCATAAACAACATAAGCTTCTGACTACTCCCACCCTCACTCCTACTCCTACTAGCCTCCTCCACTGTAGAAGCCGGAGCGGGCACCGGATGAACCGTCTACCCCCCATTAGCTGGCAACCTAGCCCATGCCGGCGCCTCAGTAGACCTGGCTATCTTCTCCCTCCACTTGGCTGGAGTATCATCCATCCTAGGGGCAATTAACTTCATCACCACTGCCATTAACATAAAACCCCCGGCGCTCTCACAATACCAAACCCCCCTATTTGTATGATCTGTCCTCATCACCGCCATTCTCCTCCTACTATCCCTCCCAGTTCTCGCCGCCGGCATTACCATACTACTAACCGACCGCAACTTAAACACCACATTCTTCGACCCCGCCGGAGGGGGCGACCCAATCCTATATCAACACCTCTTCTGATTCTTCGGCCACCCAGAAGTCTACATCCTAATCCTCCCAGGATTTGGAATTAT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Bubo bubo

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 11
Specimens with Barcodes: 12
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5