Articles on this page are available in 1 other language: Spanish (7) (learn more)

Overview

Distribution

Coereba flaveola (bananaquit) is common mainly in South America. It is most often found within the range from southern Mexico to northern Argentina and largely eastward throughout South America. It occupies most of the Caribbean Islands and on rare occasions is found in Florida (Merola-Zwartjes 1998).

Biogeographic Regions: neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

The tiny adult bananaquit ranges from about 10.5 to 11.5 cm in length. It has a dark, slender, curved beak. Although its plumage varies slightly across its geographic range, the adult plumage is nearly sexually monomorphic. In the male, the feathers on the above side are dark gray, while its crown is more black and the underside/rump is bright yellow. A long, prominent, white eyebrow (supercilium) sits directly above the eye and many times a white spot (speculum) occurs on its generally black wings. The throat is a lighter shade of gray than the back and in certain races the tail-feathers are tipped white. The female bananaquit is very similar, except that her crown is narrowly darker, her throat whitish as opposed to gray, and her rump is more of an olive-yellow shade. The young bananaquit has feathers that are far more dull than its parents' and appear more olive-yellow over its entire body. Certain races of the bananaquit tend to be entirely black, while others lack certain colors or definition in their plumage (Allen 1961; Ridgely and Tudor 1989; Fjeldsa and Krabbe 1990).

Other Physical Features: endothermic ; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The bananaquit covers a range of habitats within its geographical area. The birds are most commonly found at low elevations and rarely in the high mountainous forests. They are present in open fields, areas of cover, the dense, humid rain forests, and even in certain desert areas. Observers have spotted the bananaquit at a variety of elevations, ranging from sea level up to 4000 ft, but is most commonly seen in the lowlands (usually below 760 ft). Although, C. flaveola is present in many habitats, it is most common in the tropical region in areas with some cover (Allen 1961; Wunderle 1984).

Terrestrial Biomes: savanna or grassland ; forest ; rainforest ; scrub forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Coereba flaveola, often compared to hummingbirds, takes flower nectar as its primary source of food. Although it does use its sharp beak to pierce flowers from the side to feed, much like some hummingbirds, the bananaquit cannot hover like a hummingbird. For this reason the bird must always perch while feeding and many times hangs upside down from a branch instead of sitting upright. In addition to nectar, it eats a number of other food items that include fruits, insects, and other small arthropods. The bananaquit enjoys many kinds of fruit, including ripe bananas. It may also pick small insects from the undersides of leaves and eats flies, beetles, caterpillars, ants, bees, and spiders (Allen 1961; Skutch and Stiles 1989).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Known predators

Coereba flaveola (bananaquit) is prey of:
Buteo jamaicensis
Felis silvestris catus
Accipiter striatus
Diptera
Secernentia nematodes
Falco sparverius

Based on studies in:
Puerto Rico, El Verde (Rainforest)

This list may not be complete but is based on published studies.
  • Waide RB, Reagan WB (eds) (1996) The food web of a tropical rainforest. University of Chicago Press, Chicago
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Coereba flaveola (bananaquit) preys on:
Araneae
Pseudoscorpionida
Coleoptera
Thysanoptera
Auchenorrhyncha
Sternorrhyncha
Lepidoptera
Stylomatophora
nectar
seeds
Hemiptera
Hymenoptera
Diptera
nectar and floral

Based on studies in:
Puerto Rico, El Verde (Rainforest)

This list may not be complete but is based on published studies.
  • Waide RB, Reagan WB (eds) (1996) The food web of a tropical rainforest. University of Chicago Press, Chicago
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Average lifespan

Status: wild:
83 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 6.9 years (wild) Observations: Not much is known about the longevity of these animals. Maximum longevity from banding studies is 6.9 years (http://www.pwrc.usgs.gov/BBL/homepage/longvrec.htm), but possibly they can live significantly longer.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Reproduction varies slightly among the subspecies of C. flaveola. Typically, though, the bananaquit will raise several broods within a year and generally the breeding season lasts for five months. In certain areas the bananaquit breeds at the end of the dry season (March through early August). Breeding is also often synchronized with the first rains early in the wet season. Other times, though, breeding does not show any relationship to the seasonal weather patterns.

Bananaquit broods may contain from one to three eggs. The eggs themselves are a white-cream color (sometimes pinkish) with brown/salmon spots that vary in distribution (Allen 1961; Wunderle 1984).

Key Reproductive Features: iteroparous ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Coereba flaveola

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 52 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGACATTCGTTACCCGATGATTATTCTCAACCAATCACAAAGACATTGGAACCCTGTACCTAATCTTCGGTGCATGAGCCGGAATAGTAGGCACAGCCCTAAGCCTCCTCATTCGATCAGAGCTAGGTCAACCCGGAGCTCTCCTAGGAGACGACCAAGTCTACAACGTAGTCGTCACAGCCCACGCCTTTGTAATAATCTTCTTCATAGTTATACCAATCATGATTGGAGGCTTTGGTAACTGACTAGTCCCCCTAATAATCGGAGCCCCAGACATAGCATTTCCACGAATAAACAACATAAGCTTCTGACTACTCCCCCCATCCTTTCTCCTCCTCCTAGCATCTTCCACAGTTGAAGCAGGCGTCGGCACCGGTTGAACAGTATATCCCCCATTAGCCGGCAACCTAGCCCATGCCGGAGCATCAGTAGACCTGGCAATCTTCTCCCTTCACCTGGCCGGAATTTCCTCAATCCTAGGAGCAATCAACTTCATCACAACTGCCGTCAATATGAAACCCCCTGCCCTCTCACAATACCAAACCCCCCTATTCGTCTGATCCGTCCTAATCACCGCAGTCCTGCTACTCCTATCCCTCCCAGTCCTAGCTGCTGGAATTACAATACTCCTTACAGACCGCAACCTTAATACTACATTCTTCGACCCTGCAGGGGGAGGAGACCCAGTCCTATATCAACACCTTTTCTGATTCTTCGGACACCCAGAAGT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Coereba flaveola

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 54
Specimens with Barcodes: 109
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5