Articles on this page are available in 1 other language: Spanish (9) (learn more)

Overview

Distribution

Range Description

Tinamus major has a wide distribution within the Neotropics, with 12 recognised subspecies. Subspecies robustus occurs in south-east Mexico, east Guatemala and Honduras, overlapping with percautus, also occuring in south-east Mexico as well as north Guatemala and Belize. Subspecies fuscipennis ranges from north Nicaragua through Costa Rica to west Panama, overlapping with castaneiceps which occurs in south-west Costa Rica and west Panama. Subspecies brunneiventris is endemic to south-central Panama. Subspecies saturatus occurs in east Panama and north-west Colombia. Subspecies latifrons is distributed in south-west Colombia and west Ecuador, where it is uncommon to rare (del Hoyo et al. 1992, Restall et al. 2006). Subspecies zuliensis occurs in north-east Colombia and north Venezuela. Subspecies peruvianus ranges from south-east Colombia and east Ecuador through Peru to north-east Bolivia and extreme west Brazil. Subspecies serratus is endemic to north-west Brazil. The nominate subspecies major ranges from east Venezuela through Guyana, Suriname and French Guiana to north-east Brazil (del Hoyo et al. 1992); this taxon is abundant where forest is intact (Restall et al. 2006). Subspecies olivascens occurs in Amazonian Brazil (del Hoyo et al. 1992).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The species occurs in dense rainforest of both "terra firme" (no flooding) and "vrzea" (seasonally-flooded) types, up to 1,500 m. It feeds on the forest floor, predominantly on berries, fruits and seeds, but will also take nuts and small animals. Breeding is generally between January and July, but perhaps all year round in Suriname where it has been recorded breeding in September. The nest is made between the buttress roots of large trees (del Hoyo et al. 1992).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Tinamus major

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACCTTTACCACTCGATGATTATTCTCAACAAACCACAAAGACATCGGCACACTATACTTAATCTTTGGTGCATGAGCAGGTATAGTAGGTACAGCCCTTAGCCTGCTTATTCGTGCTGAACTTGGTCAACCAGGTACTCTATTAGGGGATGACCAAATTTACAACGTCATCGTAACAGCCCATGCCTTCGTTATAATTTTCTTCATAGTTATACCCGTAATAATCGGGGGCTTTGGAAACTGATTAGTCCCACTTATAATTGGAGCTCCTGACATAGCTTTCCCTCGAATAAACAACATAAGCTTCTGGCTCCTACCACCATCATTCCTACTTCTACTAGCTTCCTCTACCATTGAAGCTGGAGCGGGTACTGGATGAACCGTTTACCCCCCACTAGCTGGAAATATAGCCCATGCAGGCCCCTCTGTAGATCTAGCTATCTTCTCCCTACATCTTGCTGGGGTATCCTCTATTCTCGGAGCAATCAACTTTATTACTACAGCCATCAACATAAAACCGCCTGCCCTATCTCAATACCAAACCCCACTATTCGTATGATCTGTCCTAATCACTGCCATCCTTTTACTACTATCCCTTCCAGTGCTTGCTGCTGGTATTACCATACTCCTCACTGACCGAAACCTTAATACCTCATTCTTTGACCCAGCAGGAGGAGGAGATCCCATTCTATATCAACACCTATTCTGATTTTTTGGGCACCCAGAAGTTTACATCCTCATTCTCCCAGGATTCGGAATTATCTCCCATGTAGTCGCCTACTATGCTGGAAAAAAAGAACCATTCGGATATATAGGAATAGTCTGAGCAATATTATCTATTGGATTCCTAGGCTTCATCGTCTGAGCCCATCACATATTTACAGTTGGAATAGATGTTGATACACGAGCTTACTTCACATCTGCCACCATAATCATCGCCATTCCCACTGGTATTAAAGTCTTCAGCTGATTAGCCACTCTTCACGGAGGCACCATCAAATGAGACCCACCCATCCTATGAGCCTTAGGCTTTATCTTCCTCTTTACCATTGGTGGCCTCACCGGTATTGTACTAGCTAATTCCTCACTCGACATCGCTCTCCACGATACTTATTATGTAGTCGCACACTTCCACTATGTCTTATCCATAGGGGCTGTATTTGCTATCCTAGCTGGATTTACACACTGATTCCCCCTATTTACCGGATTTACCCTACACCCAACTTGAGCAAAAGCCCACTTCGGAGTTATATTTACAGGAGTAAACCTAACCTTTTTCCCACAGCATTTCCTAGGACTAGCTGGAATACCACGGCGATATTCTGACTACCCAGATGCCTACACCATTTGAAATACTGTGTCCTCTATTGGTTCTCTAATCTCCATAACTGCTGTCATTATACTCATATTCATTATCTGAGAAGCATTTTCTTCCAAACGAAAAATCCAACAACCTGAACTAACCTCTACAAATATTGAATGAATCCACGGTTGTCCACCCCCACACCACACCTTTGAAGAGCCAGCTTATGTTCAAGTCCAAGAAAGG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tinamus major

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Taylor, J. & Butchart, S.

Contributor/s
Lees, A. & Panjabi, A.

Justification

Based on a model of future deforestation in the Amazon basin, and the speciess susceptibility to habitat fragmentation and hunting, it is suspected that its population will decline by 25-30% over the next three generations, and it has therefore been uplisted to Near Threatened.


History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5