Articles on this page are available in 3 other languages: Chinese (Simplified) (6), Spanish (4), Italian (2) (learn more)

Overview

Brief Summary

Biology

The kingfisher feeds mainly on fish and invertebrates, which it catches by perching on a convenient branch or other structure overhanging the water, and plunging into the water when suitable prey comes within striking distance (2). If a suitable perch is not present, individuals may hover over the water whilst searching for prey (2). During the breeding season, pairs perform a display flight whilst calling. The nest consists of a tunnel in a riverbank or amongst the roots of a tree; both sexes help to excavate the tunnel, which terminates in a rounded chamber. In April or May 6-7 whitish eggs are laid on the bare earth, but after some time regurgitated fish bones form a lining to the nest chamber. Both parents incubate the eggs for 19-21 days. The young fledge after around 23-27 days, before this time they may eagerly approach the entrance of the tunnel when waiting to be fed (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

The beautiful iridescent plumage of the kingfisher makes it one of our most colourful and instantly recognisable birds; despite this it is rarely seen due to its shy nature (2). The upperparts are bright blue, while the underparts are a rich chestnut-red (4), although if seen in flight these colours may not be very obvious (8). The bill is very long and dagger-like (4). Although the sexes are generally similar, in breeding pairs they can be distinguished by the bill; in females it has a red base, whereas in males it is completely black (2). Although similar to adults, juveniles have duller, greener plumage (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Longueur 16-17 cm, envergure 24-26 cm, poids 34-46 g.

Le Martin-pêcheur recherche les eaux riches en petits poissons et libres de glace en hiver. Il préfère les eaux douces aux eaux saumâtres ou salées pour la reproduction et apprécie la présence de perchoirs pour ses affûts. Il a également besoin de talus pour y creuser le tunnel du nid.

L’alimentation est principalement constituée de poissons et d’insectes aquatiques, plus rarement de crustacés, mollusques, insectes terrestres et amphibiens. Il se nourrit en plongeant, soit depuis un perchoir, soit après un vol sur place. Les ailes sont étendues dans le prolongement du corps au moment de la pénétration dans l’eau.

Les Martins-pêcheurs d’Europe sont plutôt solitaires en dehors de la saison des nids et beaucoup défendent un territoire alimentaire. Le mâle adulte défend habituellement le territoire de nidification de l’été précédent, tandis que la femelle reste à proximité. L’espèce est normalement monogame. Bien que la fidélité du couple puisse exister d’une saison sur l’autre, le changement de partenaire et de territoire peut avoir lieu au cours de la saison de reproduction. La formation du couple débute par de bruyantes poursuites aériennes près du site de nid. Les simulacres de nourrissage se déroulent peu avant la finition du nid.

Ce dernier est creusé sur les rives abruptes d’une rivière ou d’une carrière, le plus souvent au-dessus de l’eau. Le tunnel mesure ordinairement entre 45 et 90 cm, avec une chambre d’incubation au bout, à l’horizontale ou légèrement plus haute que l’entrée. La ponte de 6-7 œufs (maximum 8) commence en avril et la couvaison dure 3 semaines. Les jeunes s’envolent durant leur 4e semaine et deviennent indépendants au bout de quelques jours. Il arrive qu’il y ait une 2e, voire une 3e couvée annuelle.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Muséum national d'Histoire naturelle. Service du Patrimoine naturel

Source: Inventaire National du Patrimoine Naturel

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Summary

A small kingfisher with a short tail and large head and long bill. Blue upperparts and orange underparts.
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Alcedo atthis is found throughout Europe and Asia as far east as Japan. They are also found in Africa, south of the Sahara. Common kingfishers are year long residents in their southern habitats, while northern populations travel south during the winter to escape freezing water. Alcedo atthis is the only species of kingfisher in much of its European range.

Biogeographic Regions: palearctic (Native ); oriental (Native ); ethiopian (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

In Britain, this species is widespread (4); its stronghold is central and southern England (5), becoming scarce in Scotland (4). Until the mid 1980s, the kingfisher underwent a decline in both range and numbers in its main habitat of linear waterways. Since then, it seems to have experienced a recovery, however it is not yet clear if this recovery is complete (6). Elsewhere, this species is found across Europe, and in most of Asia, reaching as far east as Japan. It also occurs in Africa south of the Sahara (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Common kingfishers are reknowned for their iridescent blue plumage. The entire upper portion of the bird: wings, back, and head are completely blue. The underbelly and a small patch underneath the eyes are rich chestnut. The throat and a small part of the side of the neck is bright white. They have small red feet. Their beaks are long, sharp and strong for the purpose of catching and holding prey. Males and females are very similar except for their beaks. A male’s beak is jet black, while the lower half of a female’s beak is chestnut. Juvenile’s are slightly more green and duller than adults.

Range mass: 26 to 39 g.

Average mass: 34 g.

Average length: 17 cm.

Range wingspan: 24 (low) cm.

Average wingspan: 26 cm.

Average basal metabolic rate: 0.3780 cm3.O2/g/hr.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes colored or patterned differently

Average basal metabolic rate: 0.378 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

"A dapper blue and green little kingfisher, with deep rust coloured underparts. Sexes alike."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

"About that of the House-Sparrow, with a short stumpy tail and a long, straight pointed bill."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Common kingfishers are found on the shores of lakes, ponds, streams, and in wetlands. They have even been known to fish in brackish waters, especially during the winter months, when other bodies of water may be frozen.

Range elevation: 0 to 190 m.

Habitat Regions: temperate ; terrestrial ; saltwater or marine ; freshwater

Aquatic Biomes: lakes and ponds; rivers and streams; coastal ; brackish water

Other Habitat Features: riparian ; estuarine

  • Bannerman, D. 1955. The Birds Of The British Isles. Edinburgh: Tweedale Court London: 39a Welbeck Street: Oliver and Boyd LTD..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Habitat

"Seen singly, by stream, tank or puddle ; perched on an overhanging branch or flying swiftly near the surface."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

May inhabit all types of fresh water, including ponds, canals, rivers and streams (4). It may also exploit brackish waters on the coast and marshes (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Common kingfishers hunt for prey from a perch above the water. Perches may be several centimeters to several meters above the water. When they see potential prey, they dive into the water, grab the prey, and fly back out. Sometimes when a perch is unavailable they will hover above the water to search for prey. After catching a fish, common kingfishers will hold the prey by its tail, and whack it against the perch. This stuns or kills the prey, which is particularly important when eating fish with spines. After consuming a fish it will regurgitate a pellet of indigestible bone.

Common kingfishers eat mostly small fish, making up 60-67% of their diet. They may also eat small arthropods, such as Gammarus fasciatus. Crustacea consist of 5-33% of their diet. Common kingfishers have also been known to eat crabs and other small marine animals during the winter.

Animal Foods: fish; insects; aquatic crustaceans; other marine invertebrates

Primary Diet: carnivore (Piscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Kingfishers are a good indicator of ecosystem health. Because kingfishers eat small aquatic animals, they are severely effected by toxins in the water. A strong kingfisher population usually means a healthy enviroment. Common kingfishers are important predators on small fish in freshwater habitats throughout their range.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Common kingfishers have few natural predators as adults.  However, because they are high on the food chain, they are susceptible to the effects of bioaccumulation, the concentration of pollutants as they climb the food chain. Nestlings may be preyed on by snakes and other ground-dwelling predators, but kingfishers are aggressive birds and do defend their young against predators.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Common kingfishers have advanced eyesight, with the ability to polarize light, reducing the reflection of light off of water. They also learn to compensate for refraction, allowing them to catch prey more effectively. Common kingfishers communicate vocally. They are well known for their long, trilling call which sounds like a repetition of “chee”. When mating, a male will whistle loudly to a female and chase her above and through the trees. In a dive for prey, a membrane covers their eyes and they rely solely on touch to know when to snap their jaws shut.

Communication Channels: visual ; acoustic

Perception Channels: visual ; polarized light ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Behaviour

"This little kingfisher is commonly found by streams, village tanks, roadside puddles, kutcha wells, brackish backwaters and even at pools left by the receding tide on the rocky seashore. It avoids forest and torrential hill streams. The bird is normally seen singly, perched on some favourite stake or stone standing in water, or on an overhanging branch or reed stem, keeping a look out for prey sailing past or rising near the surface, from time to time it bobs its head, turning it from side to side, and jerks its stub tail to the accompaniment of little subdued clicks. It darts swiftly over the water from one part of the stream or tank to another, uttering a sharp chi-chcc, chi-chec. Now and again it will suddenly drop from its perch, bill foremost, and disappear with a splash below the surface, presently to emerge; with a small fish held crosswise in its bill. With this, it usually dashes off at top speed to another perch some distance away where the quarry is battered to pulp and swallowed, head first. Occasionally it also hovers over the water and plunges in after prey in the manner of the pied Kingfisher. Its diet consists of small fish, tadpoles, water beetles and their larva;, and other aquatic insects."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Common kingfishers can live for as long as 15 years. The average lifespan is 7 years. However, the first months of development are the most dangerous with only 50% of the young surviving to adulthood.

Range lifespan

Status: wild:
21 (high) years.

Average lifespan

Status: wild:
7 years.

Average lifespan

Status: captivity:
21 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 21 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Mating is the only time that Alcedo atthis individuals are not solitary. At the beginning of the mating season, males will chase females through the trees, producing a loud whistle. Common kingfishers will find a new mate each year. Mating only occurs in the warmer months of the year, starting in April and ending sometimes as late as October.

Mating System: monogamous

In about mid-March nesting begins. The male and female work together to dig a hole into a bank along a water source. Common kingfishers prefer steep banks. The holes are of various depths and are dug into various types of soil. Usually a hole between 15 and 30 cm long is dug, but on occasion some as deep as 1.2 meters have been discovered. They may nest in clay, rock, or sandy ground. Nests also vary in the distance they are above the water, with the distance varying from 0.5 to 37 meters above the water level.

Both parents will raise and feed the young. However, the female will do most of the work. Common kingfishers will brood 2 to 3 clutches a year. These clutches consist usually of 6 or 7 eggs, but there may be as many as 10.

Breeding interval: Common kingfishers have 2-3 clutches yearly, one in April, another by July, and sometimes, a final clutch in early October.

Breeding season: Breeding occurs from early April until early October.

Range eggs per season: 4 to 10.

Average eggs per season: 6.

Range time to hatching: 18 to 21 days.

Range fledging age: 23 to 27 days.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Both males and females help to raise the young. For 19-21 days they incubate the eggs. Both will incubate during the day, only the female at night. Both have active roles in brooding and feeding the young, but the female does most of the work. One parent will hunt, then return with a fish exactly the right size for the young, they will also hold it by the tail so that the young can swallow the fish head first. When the young are able, they will eagerly wait at the opening of the burrow to be fed. After 23-27 days the young fledge and emerge from the nest.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

"The usual months are from March to June. Favourite sites are the banks of streams, tanks and ditches into which are burrowed horizontal tunnels about 2 inches in diameter and from a foot to 4 feet in length, terminating in a widened nest chamber 5 or 6 inches across. An evil stench invariably pervades the abode, caused by the indiscriminate litter of fish bones and the remains of hard-shelled insects disgorged by the birds. The normal clutch consists of five to seven eggs— pure white, roundish ovals with a high gloss. Both sexes share in excavating the nest-tunnel, incubation and feeding the young."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Structures create colorful feathers: common kingfisher
 

Feathers of the common kingfisher create colorful feathers due to pigment granules, spongy nanostructures, and thin films.

   
  "The bright colours of the common kingfisher A. [Alcedo] atthis are created by two types of feather barb: one filled with pigment granules and the other with quasi-ordered channel-type keratinous sponges. A broad-band background reflection is added by the cortex of the shiny feathers, especially when the feathers are illuminated from oblique directions." (Stayenga et al. 2011:3966)
  Learn more about this functional adaptation.
  • Stavenga DG; Tinbergen J; Leertouwer HL; Wilts BD. 2011. Kingfisher feathers – colouration by pigments, spongy nanostructures and thin films. The Journal of Experimental Biology. 214: 3960-3967.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Functional adaptation

Beak provides streamlining: common kingfisher
 

The beak of kingfishers allows splashless entry into water due to the wedge shape it makes with the head that is round in cross section.

     
  "[W]e had another challenge that we pursued to the test run phase. Half of the entire Sanyo Shinkansen Line (from Osaka to Hakata) is made up of tunnel sections. When a train rushes into a narrow tunnel at high speed, this generates atmospheric pressure waves that gradually grow into waves like tidal waves. These reach the tunnel exit at the speed of sound, generating low-frequency waves that produce a large boom and aerodynamic vibration so intense that residents 400 meters away have registered complaints. For this reason, we gave up doing test runs at over 350 km/h.

"Then, one of our young engineers told me that when the train rushes into a tunnel, he felt as if the train had shrunk. This must be due to a sudden change in air resistance, I thought. The question the occurred to me - is there some living thing that manages sudden changes in air resistance as a part of daily life?

"Yes, there is, the kingfisher. To catch its prey, a kingfisher dives from the air, which has low resistance, into high-resistance water, and moreover does this without splashing. I wondered if this is possible because of the keen edge and streamlined shape of its beak.

"So we conducted tests to measure pressure waves arising from shooting bullets of various shapes into a pipe and a thorough series of simulation tests of running the trains in tunnels, using a space research super-computer system. Data analysis showed that the ideal shape for this Shinkansen is almost identical to a kingfisher's beak.

"I was once again experiencing what it is to learn from Nature, seeing first hand that a solution obtained through large-scale tests and analysis by a state-of-the-art super-computer turned out to be very similar to a shape developed by a living creature in the natural world. The nose of our new 500-Series Shinkansens has a streamline shape that is 15m in length and almost round in cross section.

"This shape has enabled the new 500-series to reduce air pressure by 30% and electricity use by 15%, even though speeds have increased by 10% over the former series. Another benefit has been confirmed through a favorable reputation among customers that these trains give a comfortable ride. This is due to the fact that changes in pressure when the trains enter tunnels are smaller." (Japan for Sustainability 2005)

  Learn more about this functional adaptation.
  • Japan for Sustainability. 2005. Shinkansen Technology Learned from an Owl? The story of Eiji Nakatsu. Japan for Sustainability Newsletter [Internet],
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Alcedo atthis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 11 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTCTCCAACCACAAAGACATTGGCACTTTATACCTAATCTTCGGCGCATGAGCCGGCATAGTCGGCACCGCCCTAAGCCTACTCATCCGCGCCGAACTAGGTCAACCAGGCACACTCTTAGGGGATGACCAAATCTACAACGTAATCGTCACCGCCCATGCCTTCGTCATAATCTTCTTCATAGTCATACCCATCATAATCGGCGGGTTTGGAAATTGACTTGTCCCCCTAATAATCGGAGCCCCAGACATGGCATTTCCCCGCATAAACAACATAAGCTTCTGACTCCTTCCACCATCCCTCCTATTACTCCTAGCCTCCTCTACAGTTGAAGCAGGAGCTGGCACAGGCTGAACTGTATACCCCCCCCTAGCCGGCAACCTCGCCCACGCTGGACCTTCAGTAGACTTAGCCATCTTTTCACTTCACTTAGCAGGAGTATCCTCCATCCTAGGGGCAATTAACTTTATCACAACCGCTACCAACATAAAACCCCCAGCCCTCTCCCAATACCAAACTCCACTTTTCGTGTGATCCGTACTAATTACCGCCGTACTTCTCCTCCTATCACTACCGGTCCTTGCCGCTGGCATTACAATATTATTAACAGACCGCAACCTAAATACCACTTTCTTCGACCCCGCTGGAGGAGGAGATCCAATCCTATACCAACACTTATTCTGATTCTTCGGCCATCCCGAGGTCTACATCCTAATCCTCCCAGGATTTGGA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Alcedo atthis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 13
Specimens with Barcodes: 30
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend is not known, but the population is not believed to be decreasing sufficiently rapidly to approach the thresholds under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5