Articles on this page are available in 1 other language: Spanish (12) (learn more)

Overview

Distribution

Strix virgata is widely distributed throughout the Nearctic and Neotropics, from northern Mexico to Brazil and Argentina.

Biogeographic Regions: nearctic ; neotropical

  • 1999. Handbook of the Birds of the World. Vol. 5. Barn-owls to Hummingbirds. Barcelona: Lynx Edicions.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Strix virgata individuals are medium-sized owls with brown eyes. They are mostly dark except for light brown facial markings. Mottled owls have yellow-grey to blue-grey bills and their toes are greyish-yellow. Their dorsal markings are much less noticeable than the vertical streaks on their chest and throat. They look larger than they are because of their thick feathers.

In owls, females are generally larger than the males. This evolution of a reversed size dimorphism has been explained in many different ways. Researchers measure body mass during the breeding season, wing length, tail length, bill length, tarsal length, and foot span. Female mottled owls weighed significantly more than males and have significantly longer wing chords. Strix virgata has the most noticable dimorphism yet documented among owls.

Range mass: 175 to 320 g.

Range length: 355 to 280 mm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: female larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Inhabiting elevations between sea level and 2500 meters, mottled owls are often quite abundant within their range. Their habitats are extensive and diverse; they can live in a wide variety of forest and thicket edge, tropical rainforest, dry thorn forest, tropical lowland forest, pine-oak woodland, and humid evergreen jungle. They can also live in areas with scattered trees, often close to towns and villages.

Range elevation: 0 to 2500 m.

Habitat Regions: terrestrial

Terrestrial Biomes: forest ; rainforest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Strix virgata individuals feed on a diverse diet including large insects such as beetles, grasshoppers, and cockroaches. They also feed on small mammals, birds, snakes, lizards, salamanders, and frogs. They are considered opportunistic feeders as they may be attracted to artificial lights. Mottled owls primarily hunt from perches which can be found along a forest edge.

Mottled owls have keen vision, hearing, and maneuverable flight, contributing to their success as predators. Although they lack color vision, these owls can rotate their heads to see in different directions. These owls also have sensitive ears that allow them to pinpoint sound sources in total darkness. Still, their ranges of hearing are not wide and contain deaf spots. Their wing feathers have adapted to dampen sound during flight, so they can approach their prey without being heard.

Animal Foods: birds; mammals; amphibians; reptiles; insects

Primary Diet: carnivore (Eats terrestrial vertebrates, Insectivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

This species is a generalist predator, and potentially impacts many prey populations.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Owls are at the top of the food web. They have no major predators.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

This species uses an array of vocalizations, such as hoots, whistles, screeches, screams, purrs, snorts, chitters, and hisses. When a mottled owl hoots, it is often territorial and associated with courting. The males have a lower pitched hoot than females. When faced with a threat, owls produce clicking noises with their tongues. As part of a mating display, owls have the ability to clap their wings in flight.

Mottled owls produce an array of calls. Their territorial call consists of a series of deep hoots, sounding like "bru bru" and "bu bu bu" or cowooawoo or keeooweeyo. They also have a whistled screech. Mottled owls have been observed to have an enlarged voice box which allows them to produce low-pitched notes for their size.

Owls have keen hearing and vision in low-light situations. They lack color vision.

Communication Channels: visual ; acoustic

Perception Channels: visual ; tactile ; acoustic ; chemical

  • Gerhardt, R. 1991. Response of Mottled Owls to Broadcast of Conspecific Call.. Journal of Field Ornithology, 62: 239-244.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

There is no information available regarding the lifespan of this species.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Mottled owls are monogamous, neither female nor male have any involvement with other nesting birds besides their mate.

Mating System: monogamous

Strix virgata have smaller clutches than ecologically similar or closely related species. This species usually lays 1 to 2 eggs between February and May. Mottled owls usually nest in holes of trees, tops of broken off palm and occasionally in empty nests of other birds.

Breeding interval: Mottled owls breed once yearly.

Breeding season: The breeding season occurs between February and May.

Range eggs per season: 1 to 2.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization ; oviparous

Females incubate eggs while males find food and bring it back to the nest. Both males and females care for the young.

Parental Investment: pre-hatching/birth (Protecting: Female); pre-weaning/fledging (Provisioning: Male, Protecting: Female); pre-independence (Provisioning: Male, Protecting: Female)

  • Gerhardt, , D. Gerhardt. 1987. Size, Dimorspism, and Related Characteristics of Ciccaba Owls From Guatemala. 2nd Owl Symposium: 190-196. Accessed September 22, 2004 at http://www.ncrs.fs.fed.us/pubs/gtr/other/gtr-nc190/GERHARD.PDF#xml.
  • Gerhardt, R., D. Gerhardt, C. Flatten. 1994. Breeding Biology and Home Range of Two Ciccaba Owls. Wilson Bulletin, 106: 629-639.
  • The British Ornithologists' Union. 1985. A Dictionary of Birds. South Dakota: Buteo Books.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ciccaba virgata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATCTAGTCTTCGGCACATGAGCTGGCATAGTCGGCACCGCCCTTAGCTTACTCATCCGGGCCGAGCTAGGCCAACCCGGGACACTTCTGGGCGACGACCAGATCTACAATGTAATCGTCACCGCCCATGCCTTCGTAATAATCTTCTTCATGGTCATGCCAATCATGATCGGAGGATTTGGAAACTGACTAGTTCCACTAATAATCGGAGCTCCAGACATGGCCTTCCCCCGTATAAACAACATAAGCTTCTGACTTCTACCACCCTCATTCCTACTCCTGCTAGCCTCCTCCACAGTAGAGGCCGGAGCAGGCACCGGATGAACTGTCTACCCCCCACTAGCCAGCAACCTAGCCCACGCTGGAGCCTCAGTAGACCTAGCCATTTTTTCCCTCCATCTAGCAGGGGTATCCTCCATCCTCGGGGCAATCAACTTCATCACCACTGCCATCAACATAAAACCCCCATCTCTGTCACAGTACCAAACTCCCCTGTTTGTCTGATCCGTCCTCATCACCGCCATTCTTCTACTCCTGTCGCTCCCAGTCCTTGCTGCAGGCATCACCATACTATTAACTGACCGCAACCTAAACACCACATTCTTCGATCCTGCCGGCGGAGGTGACCCAGTCCTTTATCAACACCTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Ciccaba virgata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5