Overview

Distribution

Range Description

This widespread species ranges from the Near East, through the north of the Arabian Peninsula and Iran to most of South Asia. It has been recorded from southeastern Turkey (Yiit et al. 2001), eastern Syria, Kuwait and Iraq (Harrison and Bates 1991), ranging through much of central and southern Iran to Pakistan and Afghanistan, from here it ranges throughout India, and Sri Lanka, being also widely distributed through much of Nepal south of the Himalayas. It ranges in elevation from sea level up to 2,000 m (Molur et al. 2005).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The range of Tatera indica includes India, Sri Lanka, Pakistan, as far west as Syria, and north to Afghanistan and Nepal.

Biogeographic Regions: palearctic ; oriental

  • Prater, S. 1980. The Book of Indian Mammals. India: Bombay Natural History Society.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

"
Global Distribution

Afghanistan, India, Iran, Iraq, Kuwait, Nepal, Pakistan, Sri Lanka

Western Ghats Distribution

INDIA Goa: ? Locations Karnataka; ? Locations Mysore Kerala; Palakkad: Thiruvazhamkunnu; Thiruvananthapuram; Thrissur: Vellanikara Maharashtra? Locations Tamil Nadu ? Locations; Coimbatore: Anaikatty; ; Nilgiris: Mudumalai;

Known Presence in Protected Areas

India Karnataka: Bannerghatta NP Tamil Nadu; Kalakad-Mundanthurai TR, Mudumalai WS, Srivilliputhur Grizzled Giant Squirrel Sanctuary Kerala: Periyar Tiger Reserve Goa; Bhagwan Mahaveer Wildlife Sanctuary

"
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Tatera indica is one of the largest species in the murid subfamily Gerbillinae. Body mass ranges from 100 to 227 grams, and body length from 15 to 17 centimeters. Color ranges from reddish brown to fawn. Thick fur covers the body but the tail hair is sparse. A small tuft of black hair is found at the tip of the tail. The tail is approximately one half the body length of the animal and has a light brown band on each side. The soles of the feet are hairless and pigmented, as in other members of the genus Tatera, while the ears are also naked and elongated.

Range mass: 100 to 227 g.

Range length: 150 to 170 mm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike

Average basal metabolic rate: 0.422 W.

  • Prakash, L., P. Gosh. 1975. Rodents in Desert Environments. The Netherlands: Dr. W. Junk b.v. Publishers.
  • Vaughn, T., J. Ryan , N. Czaplewski. 2000. Mammalogy, Fourth Edition. Pennsylvania: Saunders College Publishing.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is found in a range of dry or arid habitats. In South Asia, it occurs in dry deciduous forests, scrub forests, grasslands, rocky areas, hot deserts, arid and semi-arid regions and uncultivated areas. It has been found to occupy undisturbed barren open areas (Molur et al. 2005). In Turkey, it appears to prefer uncultivated arid and semi-arid habitats with soft soil and dry river slopes (Yiit et al. 2001). Harrison and Bates (1991) indicatethat the species can be found in agricultural country not far from water, including heavily grazed areas.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Tatera indica individuals prefer sandy plains and grasslands that allow extensive burrowing. They will dig extensive burrows with chambers for resting, food storage, and sleeping. The depth of a burrow depends on the surrounding soil composition and season. These gerbils are generally not found in areas with very low rainfall or cold temperatures. They occupy almost any kind of habitat if there is enough suitable food and are found frequently near agricultural fields. These are perhaps the most common gerbil species throughout much of their range.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: desert or dune ; savanna or grassland

Other Habitat Features: agricultural

  • Goyal , S., P. Ghosh. 1993. Burrow Structure of 2 Gerbil Species of Thar Desert, India. Acta Theriologica, 38/4: 453-456.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Habitat

"
Habitat

Tropical and subtropical dry deciduous forests, scrub forests, grasslands, rocky areas, hot deserts, arid and semi-arid regions, uncultivated areas

Niche

Undisturbed barren open areas

Habitat Status

Stable, this species is adept to changing habitats

"
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

The diet of Indian gerbils consists of grasses, leaves, roots, and grains. They also eats grubs, insects, and nestling ground birds. T. indica store grain in their burrows for consumption in the dry season and move on to roots and fruits of plants when the stores have been consumed. During the wet season insect availability increases and the proportion of insects and other arthropods in their diet rises to as high as 40%. This species has also been known to kill and eat smaller rodents and other mammals. Cannibalism on young is common in both captivity and the wild.

Animal Foods: birds; mammals; insects; terrestrial non-insect arthropods

Plant Foods: leaves; roots and tubers; seeds, grains, and nuts; fruit

Foraging Behavior: stores or caches food

Primary Diet: omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

The role of Tatera indica in the ecosystem is not well understood. However, it is clear that, through their abundance and food habits, they significantly impact populations of plants and arthropods throughout their range. They also serve as an important prey base for birds of prey and other small to medium-sized predators. Their burrowing activities aid in soil turnover and the re-distribution of soil nutrients.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

These gerbils are primarily preyed on by birds of prey, especially owls. Jackals, snakes, lizards, cats, and foxes will also eat these gerbils. Their primary means of escaping predation are nocturnality, escaping to their burrows, and heightened senses that allow them to detect predators. They are also very fast and can leap meters into the air when surprised.

Known Predators:

  • owls (Strigiformes)
  • hawks and falcons (Accipitridae)
  • golden jackals (Canis aureus)
  • snakes (Serpentes)
  • monitor lizards (Varanus)
  • foxes (Vulpes)
  • domestic cats (Felis silvestris)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Tatera indica is prey of:
Strigiformes
Serpentes
Varanus
Vulpes
Felis silvestris
Canis aureus
Falconiformes

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Tatera indica preys on:
Arthropoda
Insecta
Aves
Mammalia

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Little research has been conducted on communication in Tatera indica. However, like most mammals, they communicate through auditory, chemical, visual, and tactile signals. As nocturnal rodents it is likely that they perceive their environment largely through auditory and chemical signals, as well as using their vibrissae to sense tactile stimuli.

Communication Channels: visual ; tactile ; acoustic ; chemical

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Behaviour

"Nocturnal, fossorial, gregarious, omnivorous"
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

A captive Tatera indica lived for 7 years. In the wild, however, most individuals don't survive their first year of life and adults probably live only a few years.

Range lifespan

Status: captivity:
7 (high) years.

Average lifespan

Status: captivity:
7.0 years.

Average lifespan

Status: captivity:
7.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 7 years (captivity) Observations: One captive specimen lived for 7 years (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Males and females of this species live apart. The relationship between the sexes is currently not known.

It is not yet known whether mating occurs above or below ground in burrows. Duration of the estrous cycle was found to be 4.5 days in the laboratory. The gestation period for T. indica ranges from 21 to 30 days, with litter size ranging from 1 to 10 young, with 5 to 6 being the most common number of young per litter. Young Indian gerbils are independent as early as 21 days of age and reach sexual maturity as early as 10 weeks of age. Females attain sexual maturity earlier than males.

Breeding interval: Indian gerbils can breed multiple times throughout the year, the interval is not well known.

Breeding season: Indian gerbils breed throughout the year, with peaks in February, July, August, and November.

Range number of offspring: 4 to 10.

Range gestation period: 21 to 30 days.

Range time to independence: 21 (low) days.

Range age at sexual or reproductive maturity (female): 10 (low) weeks.

Range age at sexual or reproductive maturity (male): 10 (low) weeks.

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; viviparous

Average birth mass: 3 g.

Average number of offspring: 5.4.

Parental care in T. indica has not been described. However, as in all mammals, females nurse and care for their young until they reach independence. The young are born in a relatively helpless state in a nest chamber in a burrow. Their eyes open at 14 days old.

Parental Investment: altricial ; female parental care

  • Nowak, R. 1991. Walker's Mammals of the World. Baltimore: The Johns Hopkins University Press.
  • Prater, S. 1980. The Book of Indian Mammals. India: Bombay Natural History Society.
  • Thomas, B., M. Oommen. 1999. Reproductive biology of the South Indian gerbil <> under laboratory conditions. Mammalia, 63/3: 341-347.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Tatera indica

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

ACTAATCACAAAGATATTGGGACACTATACCTAATTTTTGGTGCTTGAGCAGGTATAGTAGGAACAGCCCTAAGTATTCTAATCCGTACAGAATTAGGGCAACCAGGTGCCCTACTAGGAGATGATCAAATCTACAATGTAATTGTTACCGCCCATGCTTTTGTCATAATTTTCTTTATGGTAATACCTATAATAATTGGAGGTTTTGGAAACTGACTTGTTCCACTTATAATTGGAGCACCAGACATAGCTTTCCCACGAATAAATAACATAAGCTTCTGACTTTTACCTCCTTCATTTCTCCTTCTTCTAGCATCATCAATAGTAGAAGCCGGAGCAGGAACAGGCTGAACAGTATATCCACCCCTAGCTGGAAACTTAGCCCATGCAGGAGCATCAGTAGACCTGACAATTTTTTCCTTACACTTAGCAGGTGTTTCATCAATCTTAGGTGCTATTAACTTTATCACAACTATCATCAATATAAAACCACCTGCTATAACACAATATCAAACACCCCTATTTGTATGATCTGTACTAATCACCGCAGTCCTTCTTTTACTTTCACTTCCTGTTTTAGCAGCAGGTATTACAATACTTTTAACCGACCGCAATCTTAACACAACCTTCTTTGATCCTGCTGGAGGAGGGGATCCAATCCTTTATCAACATCTATT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tatera indica

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Krytufek, B., Shenbrot, G., Sozen, M. & Molur, S.

Reviewer/s
Amori, G. (Small Nonvolant Mammal Red List Authority) & Cox, N. (Global Mammal Assessment Team)

Contributor/s

Justification
Listed as Least Concern in view of its wide distribution, presumed large population, and because it is unlikely to be declining fast enough to qualify for listing in a more threatened category.

History
  • 1996
    Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Tatera indica is not listed by CITES or the IUCN, they are the most common species of gerbil in the Indian subcontinent and are abundant throughout their range.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

LEAST CONCERN
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The species is locally abundant.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

"Very common, affects borders of cultivated lands, rocky regions"
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There are no major threat to this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

"Habitat loss and degradation due to expansion of agricultural activities, agro-industry based farming activities, expansion of human settlements, stone quarrying, invasion of exotic plant species, hunting for local consumption purposes, accidental mortality due to poisoning for hunting, pest control practices, natural calamities like drought, presence of predators"
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Legislation

"India Schedule V of the Indian Wildlife (Protection) Act, 1972, amended up to 2002."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Protection Legal Status

Not listed
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
It is found in numerous protected areas. It is listed in the Schedule V (considered as vermin) of the Indian Wildlife (Protection) Act, 1972.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Tatera indica are crop pests, especially in areas where grain is stored. The animals will feed on seeds, sprouts, mature plants, ears of corn, and saplings in orchards.

The presence of this species in villages results in transfer of fleas from wild to domestic rodents, which may be partly responsible for the transmission of bubonic plague in and around India.

Negative Impacts: injures humans (carries human disease); crop pest

  • Kumar, K., S. Jamil-Ur-Rahman, S. Sharma, K. Gill, R. Katyal. 1997. Entomological and rodent surveillance in plague-suspected area during September 1994 and thereafter. Japanese Journal of Medical Science and Biology, 50/3: 97-111.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

These gerbils consume large quantities of insects which are potential agricultural pests. Indian gerbils are also hunted for food in southern India.

Positive Impacts: food ; controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Uses

For local consumption
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Indian gerbil

The Indian gerbil, Tatera indica, also known as "Antelope rat", is a species of gerbil in the family Muridae. It is found in Afghanistan, India, Iran, Iraq, Kuwait, Nepal, Pakistan, Sri Lanka, and Syria. It is the only species in the genus Tatera. Members of the genus Gerbilliscus have historically been placed in the genus Tatera.

Known as "weli meeya" or වැලි මීයා in Sinhala meaning 'Sand mouse".

Description[edit]

Head and body length is 17-20cm. Tail is 20-21cm. Dorsal surface including entire head is light brown or light brown with rusty wash. Underparts are white. Tail fully furred, dark blackish brown with grayish sides and prominent black tuft on tip. Fur on body soft, sparse underneath; tail fur is longer. Eyes are large and prominent. Bounding gait is distinguished when running.[1]

Distribution[edit]

Indian gerbils are prevalent all throughout south Asia, and particularly in India, Pakistan and Sri Lanka. These rodents also sometimes live in more western locations of the Middle East, such as Syria, Iran, Kuwait and Turkey. Indian gerbils can also be found in Afghanistan and Nepal.

Diet[edit]

Omnivorous. Known to eat grains, seeds, plants, roots, insects, reptiles and even small birds and mammals it can catch up..[1] Insects make up an especially large portion of their diets in monsoon season. Indian gerbils even occasionally consume other tiny rodents.

Ecology & Habitat[edit]

These light brown gerbils are serious about burrowing, and therefore tend to gravitate toward places that allow for it. Indian gerbils burrow for a lot of reasons, which include keeping sustenance tucked away and resting. Some typical environments for these animals are plains with ample sand, grasslands, deciduous forests, hot and arid deserts, scrub forests and very rugged regions. Indian gerbils are especially common in arid and dry climates. It is also not rare to see them in areas of farmland, particularly those that are close to water sources.

Farmers often consider Indian gerbils to be vermin or pests due to the crop destruction they cause. These gerbils often feed on grain, seeds, saplings, corn ears and sprouts when in agricultural sites.[2]

This gerbil's preferred habitat is almost anywhere that is not too sandy, or too cold. In India burrows of Indian Gerbils have been found alongside main streets in the towns, and even in the granaries of the major cities of Pakistan. In Indian villages, they often burrow into hedgerows and mud walls that border the fields. They are very common in areas of human habitation and in Iraq and Syria it is almost only found near villages. In Iran they live more remotely in areas with green vegetation all year round. In Afghanistan they are found near to isolated buildings on the edges of semi-desert areas and in dry stream beds. As high altitude brings colder temperatures they become rarer as the ground rises. In true desert areas such as Rajasthan they avoid shifting sand dunes and prefer the firmer plains.[3]

In the deserts of Northwest India the Indian Gerbil often lives alongside the Indian Desert Gerbil (Meriones hurrianae). This species prefers drier, sandy habitats. The difference between the two species can be seen by the way that M. hurrianae is more common in cultivated fields that are not irrigated, whilst T. indica is more common where the fields are irrigated.

In Culture[edit]

In Southern India and Sri Lanka, it is dug out of its burrows as a source of food, but in the north the animal is thought too small to be worth eating. The Indian Gerbil is also taboo to many Hindus as it is considered "A vehicle of Lord Ganesh".[4]

Notes[edit]

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!