Bradypus tridactylus Linnaeus, 1758

Pale-throated sloth


Species recognized by The Integrated Taxonomic Information System external link, T Orrell (custodian) in 
IUCN Red List Status: Least Concern (LC) external link Showing: scientific names

Media Center Navigation


Bradypus tridactylus Linnaeus, 1758

Images


Choose images

Bradypus tridactylus

Page navigation







Classification : Text | Graphic |

Barcode

Barcode data

Source and Additional Information
Location
Citation

The following is a representative barcode sequence, the centroid of all available sequences for this species.



 
There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
 

GBMA0640-06|NC_006923|Bradypus tridactylus|

ACCCGCTGACTATTCTCAACAAACCACAAGGACATCGGAACCTTGTACTTGTTATTTGGCGCCTGAGCCGGAGTAGTAGGCACTGCCTTA---AGCCTACTGATTCGAGCCGAACTGGGACAACCAGGAACCCTGCTAGGCGAC---GATCAAATTTATAATGTTATTGTTACCTCACACGCATTCATCATAATTTTCTTTATAGTAATACCAATTATAATTGGTGGCTTCGGAAACTGACTAATCCCTCTGATA---ATTGGAGCCCCTGACATAGCATTCCCCCGAATAAACAACATAAGTTTCTGATTGTTACCCCCGTCATTTTTACTCCTGCTAGCCTCCTCCATAGTAGAAGCAGGTGCAGGCACGGGCTGAACCGTGTACCCACCCCTAGCAGGCAACCTAGCTCATGCAGGTGCATCAGTCGACTTA---ACTATCTTCTCTCTGCACCTGGCAGGAATCTCATCAATTCTAGGTGCTATTAACTTTATTACCACCATCATTAACATAAAACCCCCTGCTATATCTCAATACCAAACCCCTCTATTTGTTTGATCTGTGCTAGTAACGGCAATCCTCCTCCTCCTCTCACTCCCGGTCCTGGCCGCC---GGAATCACCATACTCCTAACAGACCGCAACCTGAATACCACATTCTTTGACCCTACCGGAGGAGGGGACCCCATTCTATATCAACATCTATTCTGATTCTTCGGACACCCTGAAGTATATATTCTCATCCTGCCAGGCTTCGGCATGATCTCACATATTGTCACATACTACTCCGGGAAAAAA---GAACCCTTTGGCTACATGGGTATAGTATGGGCTATGGTATCAATCGGGTTCTTAGGCTTCATCGTCTGAGCCCATCACATATTTACAGTAGGAATAG


 
-- end --
 


Download FASTA File
"Bradypus tridactylus Linnaeus, 1758". Encyclopedia of Life, available from "http://www.eol.org/pages/129534". Accessed 20 Mar 2010.