Overview

Comprehensive Description

Description

  Common names: seabass (English), weakfish (English), corvina (Espanol), corvinata (Espanol)
 
Atractoscion nobilis (Ayres, 1860)

White seabass,     White weakfish

Elongate, fusiform, compressed, oval cross-section; eye moderate; mouth opens at front, weakly oblique, lower jaw slightly projecting; no barbel or pores under chin; teeth in multiple rows, front teeth pointed but are not canines; 13-18 gill rakers; preopercle with smooth edge; raised ridge down center of belly; dorsal with long base, deep notch between spiny and soft parts, X-XI, 21-23; anal fin II thin, short spines, 2nd  spine ~ ½ length of 1st  ray, 9-10 rays; pectoral and pelvics short; tail straight to slightly concave; scales small, all rough except smooth around eye, 70-85 on lateral line; fins not scaly.


Metallic blue to coppery above, with dark specks; belly silver; inner base of pectoral with black blotch; juveniles 3-6 dark bars on upper back, dusky yellow fins.


Size: 166 cm; 38 kg.

Habitat: rocky and algal bottoms.

Depth: 1-125 m.

Alaska to the Gulf of California.
   
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Often in schools over rocky bottom and in kelp beds (Ref. 2850). Also found in the surf zone (Ref. 2850). Young in bays and along sandy beaches (Ref. 2850). Feed on fishes, squids, and crayfish (Ref. 6885). Pelagic spawners (Ref. 56049). Excellent food fish (Ref. 9118).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species is endemic to the Eastern Pacific, and is found from Alaska to the Gulf of California. However, no recent records are available for the northern part of its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth

Depth Range (m): 1 (S) - 125 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific 
 
Global Endemism: All species, East Pacific endemic, TEP non-endemic

Regional Endemism: All species, Tropical Eastern Pacific (TEP) non-endemic, Temperate Eastern Pacific, primarily, California province, primarily, Continent, Continent only

Residency: Resident

Climate Zone: North Temperate (Californian Province &/or Northern Gulf of California), Northern Subtropical (Cortez Province + Sinaloan Gap), Northern Tropical (Mexican Province to Nicaragua + Revillagigedos)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

White sea bass can be found along the Pacific coastline, from Alaska to Baja California and in the Gulf of California. Larval and juvenile white seabass are often found in Sebastian Vizcaino Bay and San Juanico Bay, Baja California.

Biogeographic Regions: nearctic (Native ); pacific ocean (Native )

  • Donohoe, C. 1997. Age, growth, distribution, and food habits of recently settled White seabass, Atractoscion nobilis, off San Diego, California. Fishery Bulletin, Vol. 95, No. 4: 709-721. Accessed April 24, 2011 at http://fishbull.noaa.gov/954/donohoe.pdf.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Pacific: Alaska to southern Baja California, Mexico and the Gulf of California.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Size

Length max (cm): 166.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

White seabass are moderately elongate and silver. They have two dorsal fins; the anterior dorsal fin contains 9 to 11 spines, and the posterior dorsal fin contains one spine with several soft rays extending behind it. They also have pelvic fins on the thorax, which are slightly posterior to the pectoral fins, a general characteristic of the family Sciaenidae. The lower jaw is marginally longer than the upper jaw, and the teeth are relatively small. The lateral line is slightly curved and extends from the operculum past the caudal peduncle to the edge of the indented tail fin. They also have a ridge that runs along their underbelly, a characteristic unique to this species. White seabass under 61 cm in length are considered reproductively immature. Young A. nobilis have dark yellow fins, and are predominantly silver, with 3 to 6 dark vertical bars on their sides. Adults are countershaded, with a ventral silvery color and a bluish-gray or copper dorsal color. Adults can grow to be 152 cm long and can weigh up to 41 kg. Sexual dimorphism has not been reported in this species.

Range mass: 41 (high) kg.

Range length: 61 to 152 cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: sexes alike

  • 1971. California Marine Food and Game Fishes. Berkeley, Los Angeles, London: University of California Press.
  • 1983. A Field Guide to Pacific Coast Fishes : North America. Chester, Connecticut: Houghton Mifflin Harcourt.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Dorsal spines (total): 10 - 11; Dorsal soft rays (total): 20 - 23; Analspines: 2; Analsoft rays: 8 - 9; Vertebrae: 24
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 1520 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

166 cm TL (male/unsexed; (Ref. 40637)); max. published weight: 41.0 kg (Ref. 2850); max. reported age: 20 years (Ref. 56049)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Pelvic fins with fleshy appendage at base.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This demersal fish often occurs in schools over rocky bottoms and in kelp beds to depths of 125 m. It can also be found in the surf zone, with young fish found in bays and along sandy beaches (Eschmeyer et al. 1983). This species feeds on fishes, squids, and crayfish (Hart 1973).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 1 specimen in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 4 - 4
  Temperature range (°C): 21.311 - 21.311
  Nitrate (umol/L): 0.144 - 0.144
  Salinity (PPS): 34.228 - 34.228
  Oxygen (ml/l): 5.074 - 5.074
  Phosphate (umol/l): 0.352 - 0.352
  Silicate (umol/l): 3.264 - 3.264
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Salinity: Marine, Brackish

Inshore/Offshore: Inshore, Inshore Only

Water Column Position: Bottom, Bottom only

Habitat: Reef (rock &/or coral), Rocks, Reef and soft bottom, Reef associated (reef + edges-water column & soft bottom), Soft bottom (mud, sand,gravel, beach, estuary & mangrove), Sand & gravel, Estuary

FishBase Habitat: Demersal
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Atractoscion nobilis inhabits brackish waters and usually prefers demersal areas. Rocky reefs and soft bottomed habitats are ideal. Juveniles are often found in shallow water along the coast, just beyond the surf zone where they preys upon mysids and drifting macrophytes. Juveniles can also be found in estuaries and coastal bays, which serve as nursery stations until individuals are large enough to survive further offshore. Maximum depth for A. nobilis is about 122 m.

Range depth: 122 (high) m.

Habitat Regions: saltwater or marine

Aquatic Biomes: reef ; coastal ; brackish water

Other Habitat Features: estuarine

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; marine; depth range 0 - 122 m (Ref. 2850)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 1 specimen in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 4 - 4
  Temperature range (°C): 21.311 - 21.311
  Nitrate (umol/L): 0.144 - 0.144
  Salinity (PPS): 34.228 - 34.228
  Oxygen (ml/l): 5.074 - 5.074
  Phosphate (umol/l): 0.352 - 0.352
  Silicate (umol/l): 3.264 - 3.264
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 122m.
Recorded at 122 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Feeding

Feeding Group: Carnivore

Diet: octopus/squid/cuttlefish, bony fishes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Atractoscion nobilis feeds on northern anchovy, market squid, Pacific sardines, blacksmith, silversides, and pelagic red crab. Larger A. nobilis also feed on Pacific mackerel, and juveniles feed almost exclusively on mysid shrimp.

Animal Foods: fish; mollusks; aquatic or marine worms; aquatic crustaceans; other marine invertebrates; zooplankton

Primary Diet: carnivore (Piscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

White seabass are secondary and tertiary consumers of smaller fish within rocky bottom areas and giant kelp forests. It is not known whether they directly compete with other predatory fishes within these ecosystems. White seabass are host to a number of different endo- and ectoparasite. Studies have found at least three species of copepod (Neobrachiella gracilis, Lepeophtheirus thompsoni, and Lepeophtheirus abdominis) throughout the exterior body and inside the mouth. Endoparasites known to use white seabass as a host include three different species of cestodes (Lacistorhyncus tenuis, Callitetrarhynchus gracilis, and Grillotia smarisgora), which were found within the internal organs and the mesentery, and two types of protozoans (Kudoa clupeidae and Ceratomyxa venusta), found within muscle tissue and gall bladder. Other parasites known to occupy the tissues of white seabass at some point throughout their life cycle include flatworms and roundworms, most of which can be found in the intestines. White seabass rarely experience significant negative effects due to parasitic infestations.

Commensal/Parasitic Species:

  • copepod (Neobrachiella gracilis)
  • copepod (Lepeophtheirus thompsoni)
  • copepod (Lepeophtheirus abdominis)
  • cestode (Grillotia smarisgora)
  • cestode (Lacistorhyncus tenuis)
  • cestode (Callitetrarhynchus gracilis)
  • protozoan (Kudoa clupeidae)
  • protozoan (Ceratomyxa venusta)
  • flatworms (Trematoda)
  • roundworms (Nematoda)

  • Limbaugh, C. 2010. "Observations on Fishes Associated With Kelp Beds in Southern California" (On-line). Accessed April 27, 2011 at http://content.cdlib.org/view?docId=kt9t1nb3sh;NAAN=13030&doc.view=frames&chunk.id=d0e1199&toc.depth=1&toc.id=d0e288&brand=calisphere&query=white%20seabass.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Although predation on juveniles likely has a major impact on the distribution and abundance of white seabass, juvenile specific predators are currently unknown. However, it’s likely that any carnivorous fish will prey on them if they have the opportunity. Although adults have few predators within their ecosystem, great white sharks and California sea lions have been known to attack white seabass trapped in gill nets. Because it is a prized food fish, it has long been the target of commercial and sport fishers. Thus, humans are the most significant predators of white seabass. The coloration of white seabass may help help reduce risk of predation.

Known Predators:

  • humans (Homo sapiens)
  • California sea lion (Zalophus californianus)
  • great white shark (Carcharodon carcharias)

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Aside from adaptations common to most bony fish species, little is known about how Atractoscion nobilis communicates with conspecifics and perceives its local environment. However, all members of Sciaenidae produce drumming sounds, a characteristic unique to this family. These low-frequency sounds are created by muscles that vibrate the swim bladder, making a sound like a drum roll. Males often make drumming calls just prior to spawning.

Communication Channels: visual ; tactile ; acoustic ; chemical

Perception Channels: visual ; tactile ; acoustic ; chemical

  • Rountree, R. 2008. Passive acoustics as a tool in fisheries science. Transactions of the American Fisheries Society, 137: 533-541.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

White seabass have the largest eggs of the six of Sciaenidae species found throughout the coastal waters of southern California. Fertilized eggs (1.24 to 1.32 mm in diameter) are most commonly found off the coast of Baja California, near Sebastian Viscaino Bay and San Juanico Bay. After hatching, larvae are about 2.8 mm in length. Juvenile fry have black bands which disappear at sexual maturity around 4 years of age. Maximum length of an adult white seabass is 1.5 m, with a maximum weight of 45 kg.

  • Ambrose, D., M. Busby, J. Butler, H. Moser, E. Sandknop, E. Stevens, B. Sumida. 1983. Description of early stages of White seabass, Atractoscion nobilis, with notes on description. CalCOFI Rep, 24: 182-193.
  • California Department Of Fish And Game. California's Living Marine Resources: A Status Report. ANR Publication #SG01-11. Sacramento, California: California Department Of Fish And Game. 2001. Accessed April 29, 2011 at http://www.dfg.ca.gov/marine/status/white_seabass.pdf.
  • Steele, M., D. Pondella II, L. Allen, J. Williams. 2007. El Niño periods increase growth of juvenile white seabass. Marine Biology, 152: 193-200.
  • Zimmerman, A., M. Lowery. 1999. Hyperplastic development and hypertrophic growth of muscle fibers in the White seabass (Atractoscion nobilis). Journal of Experimental Zoology, 284: 299-308.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Pelagic spawner (Ref. 56049).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

As small fry (between 0.6 and 5.7 cm long), white seabass inhabit coastal waters ranging from 3.6 to 9 m in depth. At 1 to 3 years of age, they seek out the calm waters of various bays, where they find refuge in eel grass beds. Lifespan in the wild is unknown, however, data recovered from tagged and recaptured individuals suggests they can live to be greater than 12 years old.

Range lifespan

Status: wild:
12 (low) years.

  • California Department Of Fish And Game. White Seabass Fishery Management Plan. 04 April 2002. Sacramento, California: State of California: Department of Fish and Game, Marine Region. 2002. Accessed April 28, 2011 at http://www.dfg.ca.gov/marine/wsfmp/index.asp#reports.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 20 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Egg Type: Pelagic, Pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

White seabass are promiscuous. Males and females spawn multiple times with different partners.

Mating System: polygynandrous (promiscuous)

White seabass can spawn up to 5 or 6 times a year. Spawning generally occurs between April and August, when water temperatures are 18 degrees Celsius. Generally, white seabass reach sexual maturity between 3.5 and 4.5 years of age. Females are mature by 4 years of age and nearly 61 centimeters long, and males become sexually mature by 3 years and 51 centimeters long. Females can produce over 1.5 million eggs per spawning event. As a female becomes ready to spawn, she develops distinct black lateral bars and decreases her swim rate. When identified as a reproductive female, she is pursued by multiple males, which compete for prime spawning positions. After the eggs are fertilized, adults do not remain to protect them. Eggs develop while suspended in the water column until several months later, when they develop into free-swimming fry.

Breeding interval: White Sea Bass spawn several times a year.

Breeding season: Spawning occurs from spring to early summer.

Range age at sexual or reproductive maturity (female): 3.5 to 4.5 years.

Range age at sexual or reproductive maturity (male): 3.5 to 4.5 years.

Average age at sexual or reproductive maturity (male): 3 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (External ); broadcast (group) spawning; oviparous

As White seabass are broadcast spawners, parental care is nonexistent. Fertilized eggs develop while suspended in the water column.

Parental Investment: no parental involvement

  • California Department Of Fish And Game. California's Living Marine Resources: A Status Report. ANR Publication #SG01-11. Sacramento, California: California Department Of Fish And Game. 2001. Accessed April 29, 2011 at http://www.dfg.ca.gov/marine/status/white_seabass.pdf.
  • Drawbridge, M., S. Aalbers. 2008. White Seabass Spawning Behavior and Sound Production. Transactions of the American Fisheries Society, 137: 542-550.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Atractoscion nobilis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTACCTAGTTTTTGGTGCATGAGCCGGAATAGTGGGCACAGCTTTAAGCCTTCTAATCCGAGCAGAACTAAGTCAACCAGGCGCACTCCTCGGAGATGACCAAGTCTATAACGTAATTGTTACAGCACACGCCTTCGTTATAATTTTCTTTATAGTAATGCCCATCATAATTGGAGGATTCGGAAACTGACTTATTCCACTTATGATCGGGGCTCCCGATATAGCATTCCCTCGAATAAATAATATGAGCTTCTGACTCCTGCCCCCTTCTTTCCTCTTGCTCCTAACCTCTTCAGGGGTAGAGGCGGGAGCCGGAACGGGATGGACAGTATACCCTCCACTCGCAGGGAACCTCGCACACGCAGGGGCTTCCGTCGACTTGGCCATCTTTTCCCTACACCTCGCAGGTGTTTCATCAATTCTAGGGGCCATCAACTTTATTACAACAATTATTAACATGAAACCCCCTGCCATTTCCCAATATCAGACACCTCTATTTGTGTGGGCCGTTTTAATTACAGCCGTTCTCCTACTACTTTCACTCCCTGTCTTAGCTGCCGGCATTACAATACTTCTAACAGACCGCAACCTAAATACAACCTTCTTCGACCCAGCAGGAGGAGGCGACCCAATTCTTTACCAACACTTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Atractoscion nobilis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Chao, L., Robertson, R., Espinosa, H., Findley, L. & van der Heiden, A.

Reviewer/s
Carpenter, K., Polidoro, B. & Livingstone, S. (Global Marine Species Assessment Team)

Contributor/s

Justification
This species is relatively widespread in the Eastern Pacific, but has been historically over-fished resulting in population decline and range reduction. The population in the United States is still low relative to historical levels but has increased over the past 30 years due to fishery regulations and a captive breeding program. Recovery depends on continuation of current regulations. It is listed as Least Concern. But more survey work and continued monitoring of this species is required, especially for the disjunct subpopulation in the Gulf of California whose status is unknown, but suspected to be in serious decline from over-fishing.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List: Not evaluated / Listed

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

White seabass are currently listed as a species of least concern on the IUCN's Red List of Threatened Species. Although their numbers are low when compared to historical abundance, population size has increased over the past 30 years due to conservation and management efforts, including stricter regulations on fishing limits and the development of hatcheries. However, a small subpopulation in the Gulf of California is suspected to be in serious decline due to overfishing.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species was previously an important fishery species in California, but the population declined to commercial extinction. Populations are recovering due to fishery regulations along the coast of California that have placed restrictions on recreational fisheries and banned further commercial catch of this species (gill nets are prohibited). No population information exists for the subpopulation in the Gulf of California, but it is suspected to be in decline due to continued intensive fishing with gill nets.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
This species has been historically over-fished throughout its distribution. Its population has declined since the early part of this century, corresponding to a decline in landings since the late 1920s. Its range is now likely reduced as few are found regularly north of Point Conception, in northern California. In addition to over-fishing, pollution and habitat destruction have probably contributed to this long-term population decline and range reduction.

However, the large numbers of small White Seabass caught in recent years suggests that the warm water period beginning with the 1982-1983 El Nio event helped to increase young sh survival. Young sh surveys conducted in southern California as part of Ocean Resources Enhancement and Hatchery Program (OREHP), showed a dramatic increase in the number of fish taken in research gillnet sets. During research work in 1997 over 600 juvenile sh were captured, in 1998 approximately 700 sh were taken, and in 1999 slightly over 1,300 juveniles were captured. Anecdotal evidence from commercial and sport shers conrms this dramatic increase in juvenile White Seabass. However, it is unknown whether this increase in juveniles will subsequently enhance the adult spawning population (Vojkovich and Crooke 2001)

The subpopulation within the Gulf of California, from approximately Guaymas northward, appears to be completely disjunct and is still heavily fished by gillnet. No population data exists but the species in this region is suspected to be in serious decline.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There is a captive breeding program in California for this species, and numerous fishery regulations now in place to help restore this species population, including restrictions on recreational fisheries and further commercial catch of this species (gill nets are prohibited). In March 2004, legislation was enacted to prohibit increased fishing production of the species (Legislation number: NOM-009-PESC-1993). Commercial fishing of this species is now prohibited in California.

This species may be present in some Marine Protected Areas in Mexico, the Unites States and Canada. However, more enforcement in is needed, especially in Marine Protected Areas outside of the United States.

Research is needed to determine the status of the subpopulation of this species in the Gulf of California.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

There are no known negative economic impacts to humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

White seabass are an important commercial fish species, and are taken by commercial trawlers and sport fishermen. However, overfishing has led to a serious decline in the population, which is why white seabass hatcheries have been developed. The development of these hatcheries has helped to increase the population of white seabass and to create jobs.

Positive Impacts: food ; research and education

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Importance

fisheries: minor commercial; gamefish: yes; price category: very high; price reliability: reliable: based on ex-vessel price for this species
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

White seabass

White seabass or white weakfish, Atractoscion nobilis, is a species of croaker occurring from Magdalena Bay, Baja California, to Juneau, Alaska. They usually travel in schools over deep rocky bottoms (0-122 m) and in and out of kelp beds.

Contents

Description

Atractoscion nobilis mspc097.gif

The body of the white seabass is elongate, and somewhat compressed. The head is pointed and slightly compressed. The mouth is large, with a row of small teeth in the roof; the lower jaw slightly projects. The color is bluish to gray above, with dark speckling, becoming silver below. The young have several dark vertical bars. The white seabass is closely related to the California corbina, but is the only California member of the croaker family to exceed 20 pounds in weight. The largest recorded specimen was over 5 feet, 93.1 pounds. They are most easily separated from other croakers by the presence of a ridge running the length of the belly.

The diet of white seabass includes fishes, especially anchovies and sardines, and squid. At times, large fish are found which have eaten only Pacific mackerel. At the minimum legal length of 28 inches, the average white seabass is about 5 years of age, weighs about 7.5 pounds and has been sexually mature for at least one spawning season.

Fishing information

White seabass at the fish market in Ensenada, Mexico

White seabass are fished primarily with live bait in relatively shallow water, but they will also take a fast-trolled spoon, artificial squid or bone jig. Live squid appear to be the best bait for a white seabass, but large anchovies and medium-size sardines are also good. At times, large white seabass will bite only on fairly large, live Pacific mackerel. The young of this species are exceptionally vulnerable to sport anglers for two reasons: The first is that as juveniles they inhabit shallow nearshore areas, bays, and estuaries, and the second is that they are not easily recognized as white seabass by the average angler. Commonly, these young fish are mistakenly called "sea trout" because of their sleek profile and vertical bars or "parr marks". To add to the confusion, these bars fade as the fish grows.

In California, there is a minimum 28 inch size limit and current fishing regulations should be checked concerning bag limits.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!