Articles on this page are available in 1 other language: Spanish (6) (learn more)

Overview

Brief Summary

Introduction

A widespread neotropical species. The butterflies are rapid fliers that prefer to spend their time in the forest canopy, but may be encountered in sunny areas where trees have fallen. Note that fresh specimens exhibit a bright lime-green color on both surfaces of the wings, but that this fades in museum specimens, such as those illustrated above. Like all members of Heliconiina, Philaethria dido larvae feed on various Passiflora species (see Habits), but unlike many Heliconius, appear to specialize on older leaves (DeVries, 1987).

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

General comments

This information is based an ongoing project dedicated to the inventory and dissemination of information on lepidopteran larvae, their host plants, and their parasitoids in a Costa Rican tropical wet forest and an Ecuadorian montane cloud forest.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Morrison, Colin

Source: Plant-Caterpillar-Parasitoid Interactions

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographical races/subspecies

  • Philaethria dido dido (Linnaeus, 1763) is widespread in Central and tropical South America.
  • Philaethria dido chocoensis Constantino, 1999 is endemic to the Chocó region of northwestern Colombia.

Philaethria dido chocoensis, holotype male, dorsal surface. © 2010 Luis Constantino

Philaethria dido chocoensis holotype male, ventral surface. © 2010 Luis Constantino

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habits

Philaethria dido occurs in dense forests. Usually individuals fly rapidly in the canopy. Adults roost solitarily at night under leaves (Brown, 1981).

Hostplant: Philaethria dido larvae feed primarily on plants from the subgenera Astropea, Distephana and Granadilla (Passifloraceae)(Brown, 1981). In Costa Rica larvae feed on Passiflora vitifolia, P. edulis and P. ambigua (Passifloraceae) (DeVries, 1987).

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Characteristics

Early Stages: Eggs are yellow and approximately 1.5 x 1.2 mm (h x w). Females usually place eggs singly under older leaves of the host plant. Mature larvae have a white body with black and red stripes, with black, white and red scoli and yellow head; length is around 2.3 cm. Caterpillars are gregarious in small numbers (Brown, 1981).

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Collected in Napo Province, Ecuador (Yanayacu Biological Station and Center for Creative Studies).

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Philaethria dido

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNAACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAATTGGAACATCCTTAAGTATTTTAATTCGTATAGAATTAGGTAATCCTGGATCCTTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCATTTATTATAATTTTTTTTATAGTAATACCTATTATAATCGGAGGATTTGGAAATTGATTAGTGCCATTAATATTAGGAGCTCCTGACATAGCATTCCCCCGTATAAATAATATAAGATTTTGACTTTTACCCCCATCACTAATTTTATTAATTTCCAGTAGAATTGTAGAAAACGGTGCAGGAACCGGATGAACTGTTTACCCCCCCCTATCTTCTAATATTGCTCATAGAGGTTCCTCAGTTGATTTAGCTATTTTTTCTCTTCATTTAGCTGGAATTTCTTCAATTTTAGGAGCAATTAATTTTATTACAACTATTATTAATATACGAATTAATAATATATCTTTTGATCAATTACCTTTATTTATCTGAGCTGTTGGTATCACAGCCCTATTATTATTATTATCTTTACCAGTTTTAGCAGGAGCTATCACTATACTTTTAACTGATCGAAATTTAAATACTTCTTTTTTTGATCCTGCAGGAGGGGGAGACCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Philaethria dido

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 12
Specimens with Barcodes: 22
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Philaethria dido

The scarce bamboo page or dido longwing (Philaethria dido) is a butterfly in the family Nymphalidae. It is found in Central America and tropical South America, both east and west of the Andes, from Brazil and Ecuador northwards to Mexico. Strays can sometimes be found in the lower Rio Grande Valley in southern Texas.

Description[edit]

The butterflies have a wingspan of about 110 mm (4.3 in), and in Mexico are on the wing from July to December. The upper surface of the wings is black patterned with translucent green patches. The underside is similar with some brown streaks with gray scales.[1] Philaethria dido is often confused with Siproeta stelenes. They have a similar coloration, but their wing shapes are different and whereas P. dido flies high in the canopy, S. stelenes is often to be seen in forest clearings and open secondary forest.[2]

Subspecies[edit]

Three subspecies are recognised. Philaethria dido chocoensis is found only on the western side of the Andes, its range extending from Ecuador to the Chocó region in northwestern Colombia. Philaethria dido dido inhabits tropical rainforests of South America east of the Andes, from Colombia to Bolivia. Philaethria dido panamensis lives only in Panama, from San Blas to Chiriquí[3]

Distribution and habitat[edit]

Philaethria dido chocoensis is endemic to land west of the Andes, its range extending from the western parts of Ecuador to the Chocó region in northwestern Colombia. Philaethria dido dido has a more widespread distribution and is native to tropical forests in South America to the east of the Andes. Its range extends from Brazil to Bolivia and Colombia and northward to Mexico. Stray butterflies have occasionally been observed in the lower part of the valley of the Rio Grande in Texas.[1] This butterfly's flight is fast and direct and it mainly flits through the canopy and along the courses of streams, but it may also be seen in clearings and sunlit glades.[3] It is present in tropical rainforests at altitudes from zero up to 1200 metres (4000 ft) but it is absent from deciduous forests.[2]

Biology[edit]

Philaethria dido feeds on nectar that it obtains from the flowers of forest trees such as Cissus. The males normally fly high in the canopy but sometimes descend to sunlit stream sides or gravel beaches besides rivers to sip mineral-rich water. Females often fly at about 4 m (13 ft) off the ground, dipping down at intervals to inspect potential egg-laying sites on species of passion flower. The eggs are laid on the under sides of the leaves on species including Passiflora laurifolia, Passiflora vitifolia, Passiflora edulis, and Passiflora ambigua.[2] The larvae are light green with a covering of reddish spines. The pupa is brown blotched with grey, has a rough warty surface and resembles a bird dropping.[2]

References[edit]

  1. ^ a b "Scarce bamboo page". Butterflies and Moths of North America. Retrieved April 7, 2014. 
  2. ^ a b c d Adrian Hoskins. "Dido Longwing". Butterflies of the Amazon and Andes. Retrieved July 30, 2011. 
  3. ^ a b Margarita Beltrán; Andrew V. Z. Brower (December 9, 2011). "Philaethria dido (Linnaeus 1763)". Tree of Life Web Project. Retrieved April 7, 2014. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!