Overview

Comprehensive Description

Description

Colostethus agilis is a small frog but moderately sized for a Colostethus, attaining a SVL averaging 24 mm for males and 28 mm for females. Males have a dilated third digit. The head is wider than it is long but not as wide as the body. Snout truncated in dorsal view and projects beyond the anterior extremity of the upper labial. Nostrils are directed laterally. The ventral portion of tympanum is visible while the dorsal portion is covered by the supratympanic fold. Dorsal and gular skin is smooth. Males have vocal slits positioned posterolaterally to the tongue. Ulnar tubercles absent. Discs on toes are round and smaller than those on the hands. When adpressed anteriorly, the ankle reaches a point near the anterior portion of the orbit.

Colostethus agilis is also characterized by a a dorso-and-ventrolateral row of warts/bumps and a row of blotches laterally. In life, this Colostethus is characterized by the presence of olive dorsal coloration with brown blotches or brown dorsal coloration with black blotches. The upper lip has white spots. Thighs and inguinal region have pale whitish-yellow blotches. Iris is brown with golden specks.

Few members of the genus Colostethus have much more than basal interdigital webbing on the hind feet. Even rarer are those which have extensive, almost complete, interdigital webbing. At the time of its description, Colostethus agilis was one of only five Colostethus with such extensive webbing (the other four species were: C. chocoensis, C. fuliginosus, C. palmatus, and C. vergeli) (Lynch and Ruiz-Carranza 1985).

  • Lynch, J. D., and Ruiz-Carranza, P. M. (1985). ''Una nueva especie de Colostethus (Amphibia: Dendrobatidae) de la Cordillera Occidental de Colombia.'' Lozania, 54, 1-6.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2015 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Distribution and Habitat

Colostethus agilis is known from the western Cordillera Occidental of Colombia (Departamentos del Cauca y Valle) at elevations between 2190 and 2600 m.

  • Lynch, J. D., and Ruiz-Carranza, P. M. (1985). ''Una nueva especie de Colostethus (Amphibia: Dendrobatidae) de la Cordillera Occidental de Colombia.'' Lozania, 54, 1-6.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2015 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage

Barcode of Life Data Systems (BOLD) Stats
Specimen Records:300
Specimens with Sequences:453
Specimens with Barcodes:229
Species:28
Species With Barcodes:28
Public Records:99
Public Species:17
Public BINs:25
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Colostethus cf. pratti

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CTCGTCTTTGGTGCCTGGGCAGGAATAGTTGGAACTGCCCTAAGTCTTTTAATCCGAGCAGAATTAAGCCAGCCTGGCTCACTTTTAGGCGACGATCAAATTTACAATGTGATCGTTACAGCCCACGCTTTTGTAATAATTTTTTTTATAGTTATACCCATTCTTATTGGAGGCTTTGGTAATTGATTAGTTCCCCTGATAATTGGCGCCCCTGACATGGCCTTCCCCCGCATAAATAATATAAGCTTCTGGCTACTGCCCCCCTCATTCCTGTTACTCTTAGCTTCTGCCGGCCTTGAAGCAGGAGCAGGAACTGGATGAACAGTTTATCCCCCTCTAGCCAGCAATCTCGCTCATGCCGGCCCATCAGTTGACCTAACAATTTTTTCCCTTCACCTGGCTGGAGTCTCCTCAATTCTTGGCGCAATTAATTTTATTACCACCACCCTAAATATAAAACCCCCATCACTTACACAGTACCAAACACCTTTGTTTGTATGATCCGTTTTAATCACTGCTATTCTTCTTTTATTATCTCTCCCAGTGCTAGCCGCCGGAATTACAATACTCTTAACTGACCGTAACCTAAACACTACTTTTTTTGACCCTGCTGGAGGCGGAGACCCAATTCTCTACCAACACCTATTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Colostethus cf. pratti

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Life History, Abundance, Activity, and Special Behaviors

Individuals were found active during the day and not active at night. Adults were found at the edge of breaks in the cloud forests, where adults and juveniles were very common.

  • Lynch, J. D., and Ruiz-Carranza, P. M. (1985). ''Una nueva especie de Colostethus (Amphibia: Dendrobatidae) de la Cordillera Occidental de Colombia.'' Lozania, 54, 1-6.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2015 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Colostethus

Colostethus is a large genus of poison dart frogs native to Central and South America. There are currently over eighty species in this genus. Unlike most members of the family Dendrobatidae, members of the genus Colostethus are not usually brightly colored or poisonous. Colostethus is paraphyletic as presently delimited, because although all species have a common ancestor, not all species descended from that ancestor are included in Colostethus. Current evolutionary studies will likely result in splitting of Colostethus into segregate genera in the near future.

Since a 2006 review, Hyloxalus has absorbed many of the species, while Silverstoneia aggregated three.[1]

Species[edit]

Silverstoneia[edit]

Moved to Silverstoneia genus by Grant et al., 2006[2]

Notes[edit]

  1. ^ Grant, T., Frost, D. R., Caldwell, J. P., Gagliardo, R., Haddad, C. F. B., Kok, P. J. R., Means, D. B., Noonan, B. P., Schargel, W. E., and Wheeler, W. C. (2006). Phylogenetic systematics of dart-poison frogs and their relatives (Amphibia: Athesphatanura: Dendrobatidae). Bulletin of the American Museum of Natural History, 299, 1-262 (http://digitallibrary.amnh.org/dspace/bitstream/2246/5803/1/B299.pdf)
  2. ^ Grant, T., Frost, D. R., Caldwell, J. P., Gagliardo, R., Haddad, C. F. B., Kok, P. J. R., Means, D. B., Noonan, B. P., Schargel, W. E., and Wheeler, W. C. (2006). Phylogenetic systematics of dart-poison frogs and their relatives (Amphibia: Athesphatanura: Dendrobatidae). Bulletin of the American Museum of Natural History, 299, 1-262 (http://digitallibrary.amnh.org/dspace/bitstream/2246/5803/1/B299.pdf)
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!