Overview

Comprehensive Description

Biology

Inhabit holes and crevices in rocky areas (Ref. 2850). Found in intertidal areas and to 37 m (Ref. 2850). Viviparous (Ref. 34817).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Eastern Pacific: Eureka in northern California, USA to central Baja California, Mexico.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Maximum size: 390 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

39.0 cm TL (male/unsexed; (Ref. 2850)); max. reported age: 22 years (Ref. 39279)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Syntype for Sebastes chrysomelas
Catalog Number: USNM 26880
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan
Year Collected: 1880
Locality: California, Santa Barbara., California, United States, Pacific
  • Syntype: Jordan, D. S. & Gilbert, C. H. 1881. Proceedings of the United States National Museum. 3 (176): 465.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Syntype for Sebastes chrysomelas
Catalog Number: USNM 26968
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan
Year Collected: 1880
Locality: Monterey, Cal., Monterey County, California, United States, North America, Pacific
  • Syntype: Jordan, D. S. & Gilbert, C. H. 1881. Proceedings of the United States National Museum. 3 (176): 465.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 2 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 3.66 - 8.845

Graphical representation

Depth range (m): 3.66 - 8.845
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; marine; depth range 0 - 37 m (Ref. 2850), usually 0 - 18 m (Ref. 2850)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 2 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 3.66 - 8.845

Graphical representation

Depth range (m): 3.66 - 8.845
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 37m.
Recorded at 37 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 22 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Sebastes chrysomelas

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GATTTTCTCCACTAATCACAAAGACATCGGCACCCTTTATCTAGTATTTGGTGCCTGAGCCGGTATAGTAGGCACAGCCCTCAGCCTACTCATTCGAGCAGAACTAAGCCAACCGGGCGCTCTCCTTGGAGACGACCAAATTTATAATGTAATCGTTACAGCACATGCCTTCGTAATGATTTTCTTTATAGTAATGCCAATTATAATTGGAGGTTTTGGAAACTGATTAATTCCCCTAATGATTGGAGCCCCAGATATAGCATTTCCTCGTATAAATAATATAAGTTTCTGACTTCTGCCCCCTTCCTTCCTACTACTACTCGCCTCTTCTGGGGTAGAAGCGGGTGCCGGAACCGGGTGAACAGTGTACCCGCCCCTGGCCGGTAATTTAGCCCACGCAGGAGCATCAGTCGACCTGACAATCTTTTCACTTCACCTAGCAGGTATTTCCTCAATCCTCGGGGCAATCAATTTTATCACCACAATTATTAACATGAAGCCCCCGGCCATCTCTCAGTACCAGACACCCCTATTTGTGTGAGCTGTCCTAATTACCGCTGTTCTTCTCCTTCTCTCCCTGCCAGTTCTCGCTGCCGGCATCACAATGCTCCTTACCGACCGAAATCTTAATACCACCTTCTTTGACCCGGCCGGAGGAGGGGATCCAATCCTTTACCAGCACTTATTCTGGTTCTTTGGACACCCGGAAGTATATATTCTCATTTTGCCTGGCTTTGGTATGATTTCACACATCGTCGCCTATTACTCTGGCAAAAAAGAACCCTTTGGCTATATGGGTATAGTATGAGCAATAATGGCTATTGGTCTTCTAGGCTTTATTGTATGAGCTCATCACATATTCACAGTTGGCATGGACGTAGACACGCGTGCCTATTTTACATCTGCCACAATAATTATCGCAATTCCCACCGGCGTTAAAGTATTTAGCTGACTTGCAACCCTTCATGGGGGCTCTATTAAATGAGAGACACCCCTTTTATGGGCCCTTGGCTTTATTTTCCTGTTTACAGTAGGAGGGCTTACAGGCATTGTTCTGGCCAATTCATCTCTAGATATTGTACTCCACGATACCTATTATGTAGTAGCCCACTTCCACTACGTACTATCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Sebastes chrysomelas

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genomic DNA is available from 4 specimens with morphological vouchers housed at British Antarctic Survey
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Sebastes chrysomelas

Sebastes chrysomelas, commonly known as the black-and-yellow rockfish, is a marine fish species of the family Sebastidae. It is found in rocky areas in the Pacific off California and Baja California. Although it is similar in appearance to the China rockfish, it lacks the China's long yellow streak. Its distribution is also more to the south than the China.[2]

The black-and-yellow rockfish has speckles that are similar to the China rockfish, but lacks the long yellow streak starting at the foredorsal fin curves.[2]

References

  1. ^ http://fishbase.org/Summary/speciesSummary.php?ID=3959&genusname=Sebastes&speciesname=chrysomelas
  2. ^ a b Paul Humann (1996). Coastal Fish Identification California to Alaska. New World Publications, Inc.. ISBN 1-878348-17-5. page 27
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!